ID: 1021827455

View in Genome Browser
Species Human (GRCh38)
Location 7:24569820-24569842
Sequence GCAGCCAGGTGAGACTAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021827449_1021827455 16 Left 1021827449 7:24569781-24569803 CCAGTCGGGATGCTCAGAGCTGG No data
Right 1021827455 7:24569820-24569842 GCAGCCAGGTGAGACTAATCTGG No data
1021827448_1021827455 22 Left 1021827448 7:24569775-24569797 CCAGTGCCAGTCGGGATGCTCAG No data
Right 1021827455 7:24569820-24569842 GCAGCCAGGTGAGACTAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021827455 Original CRISPR GCAGCCAGGTGAGACTAATC TGG Intergenic
No off target data available for this crispr