ID: 1021827457

View in Genome Browser
Species Human (GRCh38)
Location 7:24569832-24569854
Sequence GACTAATCTGGAGAAGCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021827449_1021827457 28 Left 1021827449 7:24569781-24569803 CCAGTCGGGATGCTCAGAGCTGG No data
Right 1021827457 7:24569832-24569854 GACTAATCTGGAGAAGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021827457 Original CRISPR GACTAATCTGGAGAAGCTTT AGG Intergenic
No off target data available for this crispr