ID: 1021828208

View in Genome Browser
Species Human (GRCh38)
Location 7:24574367-24574389
Sequence ATCCACATCCTGTCACCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021828208_1021828211 5 Left 1021828208 7:24574367-24574389 CCGTGTGGTGACAGGATGTGGAT 0: 1
1: 0
2: 1
3: 19
4: 125
Right 1021828211 7:24574395-24574417 GGTAGATGTTTTTTTGCAGAAGG 0: 1
1: 0
2: 0
3: 11
4: 261
1021828208_1021828212 25 Left 1021828208 7:24574367-24574389 CCGTGTGGTGACAGGATGTGGAT 0: 1
1: 0
2: 1
3: 19
4: 125
Right 1021828212 7:24574415-24574437 AGGACTTTTTAACACTTTACTGG No data
1021828208_1021828213 26 Left 1021828208 7:24574367-24574389 CCGTGTGGTGACAGGATGTGGAT 0: 1
1: 0
2: 1
3: 19
4: 125
Right 1021828213 7:24574416-24574438 GGACTTTTTAACACTTTACTGGG 0: 1
1: 0
2: 0
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021828208 Original CRISPR ATCCACATCCTGTCACCACA CGG (reversed) Intronic
903919691 1:26790801-26790823 GGCCACATCCTTTCACCACCAGG - Exonic
904578943 1:31525358-31525380 AGTCACTTCCTGTCTCCACAGGG + Intergenic
904750881 1:32741151-32741173 ATCCTCATCTTGCCACCAAAGGG + Intergenic
905381528 1:37564915-37564937 ATCCACATGCTGTCACTCCAAGG - Intronic
908435770 1:64104451-64104473 ATATACATCCTGTCCCCTCATGG + Intronic
910019802 1:82573167-82573189 TACCACATCCTGCCAACACACGG - Intergenic
910444889 1:87290121-87290143 ATCACCATCTTGTCACTACAAGG + Intergenic
921048735 1:211495773-211495795 ATCTACACCCTATCATCACACGG - Intergenic
1063668826 10:8083379-8083401 AGGCACATCTTGTCACCCCAAGG - Intergenic
1065397517 10:25255560-25255582 ATCTCCATCCTATAACCACAAGG - Intronic
1065852833 10:29805121-29805143 ATACACTGCCTGTCACCACTGGG + Intergenic
1067738335 10:48876755-48876777 AGCCACTTCCAGTGACCACAGGG - Intronic
1068939682 10:62668673-62668695 AATCCCATCCTGCCACCACAGGG - Intronic
1069655522 10:70085101-70085123 ATCTCCTTCCAGTCACCACATGG - Intronic
1070917980 10:80167099-80167121 ATCCACCTTCTATCACCACTGGG + Intronic
1072614610 10:97041131-97041153 ATTCACATCCTTTCACCTCTAGG + Intronic
1072816488 10:98514649-98514671 ATCCAGATGCTGTGACCAGAAGG - Intronic
1073449085 10:103598952-103598974 ATCTACATGCTGTCACCAGATGG + Exonic
1073945513 10:108745479-108745501 ATCCACATTCTGCCTCCACATGG + Intergenic
1074213431 10:111360365-111360387 GTTTCCATCCTGTCACCACAGGG - Intergenic
1074290623 10:112135860-112135882 ATCCATTTCCTGTCACAGCATGG - Intergenic
1075099053 10:119493196-119493218 ATTCACAGCCTGCCACCCCAGGG - Intergenic
1085897410 11:80656448-80656470 ATCCAAATCCCGTAATCACAAGG + Intergenic
1086162008 11:83732518-83732540 ATCCCCATCATTTCACTACACGG - Intronic
1087446586 11:98262462-98262484 ATCCAACTCCTGTCACCACAAGG + Intergenic
1089639882 11:119840828-119840850 AACCACACCATGTGACCACATGG + Intergenic
1101533369 12:105595085-105595107 ATCCACAGCCCCTCACCTCAAGG - Intergenic
1101964752 12:109274758-109274780 ACCCACATCCTCTGACCCCAAGG - Intergenic
1103646699 12:122399320-122399342 ATCCAAATCCTGTAAGCAAAAGG + Intronic
1106228189 13:27800850-27800872 ATCTAGATTCTGTCACCAAAAGG - Intergenic
1108199377 13:48027660-48027682 AAGCACATCCAGTCAGCACAGGG + Intergenic
1112959771 13:105109197-105109219 CTCCACATCTTTTCATCACAGGG + Intergenic
1113051861 13:106221222-106221244 CTCCACTTCCTGCCACCACCTGG + Intergenic
1114143357 14:19942745-19942767 ATTAACATCCTTTCACCTCATGG - Intergenic
1114419998 14:22573993-22574015 AACCTCTTCCTGTCACCACTTGG - Intronic
1114766088 14:25372231-25372253 ATTCACTTCCTCTCACCACAGGG - Intergenic
1115354544 14:32433522-32433544 ATCCAGGTCCTGTGACCTCAGGG - Exonic
1117606061 14:57430548-57430570 CTGCACATGCTGCCACCACAGGG - Intergenic
1120820871 14:88910653-88910675 GGCCACAGCCTGTCCCCACAAGG + Intergenic
1121645214 14:95513895-95513917 ATGCTCTTCCTGGCACCACATGG - Intergenic
1121730813 14:96185760-96185782 GTCCAGATCCTGGCACTACAGGG - Intergenic
1122249049 14:100425261-100425283 GTGCACATCCTGTCACCCCATGG + Intronic
1122323631 14:100869768-100869790 GTCCACATCCCTTCACCCCAGGG - Intergenic
1122323818 14:100870810-100870832 GTCCACATCCCTTCACCCCAGGG - Intergenic
1124130566 15:26981679-26981701 TTCCCCTTACTGTCACCACAAGG - Intronic
1127991163 15:64118874-64118896 AGCCACATCCTAACATCACAAGG - Intronic
1129514779 15:76150692-76150714 CTCCCCATCCTGGCGCCACACGG + Intronic
1132006289 15:98230437-98230459 AGCCACATGCTCTAACCACAGGG + Intergenic
1132359146 15:101198040-101198062 GACCACAGTCTGTCACCACAGGG - Intronic
1134402024 16:13919212-13919234 ATACACATTCTCTCATCACACGG - Intergenic
1138073293 16:54015282-54015304 ATCAACATTACGTCACCACAAGG + Intronic
1145813150 17:27777005-27777027 ATCCACATCCTGCCAGCATCAGG + Intronic
1146477100 17:33171835-33171857 CTCCACTCCCTCTCACCACAAGG + Intronic
1146911765 17:36652970-36652992 AGCCACACCCTGTACCCACAGGG - Intergenic
1149646377 17:58244580-58244602 ATCCTCAGCCTGACCCCACAGGG + Intronic
1150866550 17:68856726-68856748 AGCCCCATCCTGTCATCCCAGGG + Intergenic
1151908405 17:77064901-77064923 ATCCCCATCCTGCCACTTCAAGG - Intergenic
1152228326 17:79102755-79102777 GTCCCCAACCTGTCCCCACATGG - Intronic
1154461372 18:14591107-14591129 ATTAACATCCTTTCACCTCATGG - Intergenic
1157346660 18:46842511-46842533 TTCCACATACAGTCACCATATGG - Intronic
1161175637 19:2841038-2841060 ATCCACCTCCTGTCCGGACAAGG + Intergenic
1162650239 19:12083019-12083041 AGCTACCTCCTCTCACCACAAGG - Intergenic
1165367888 19:35380725-35380747 TTTCACCTCCTGTCACCACATGG + Intergenic
1165545853 19:36535313-36535335 GTCCATATCCTGTCACCACGTGG + Intronic
1167380359 19:49134710-49134732 ATCCTCCTCCTGTCCCCTCAGGG - Intronic
927406307 2:22773432-22773454 ATCCACATCCTGCTACCACTTGG - Intergenic
928727987 2:34197307-34197329 ATCAACATGCTGTTACCAGATGG + Intergenic
931359658 2:61567258-61567280 TTCCACAGCCTCTCAACACAGGG + Intergenic
933726347 2:85429748-85429770 CTCCACTTCCTGTCAGCACTAGG + Intronic
934583731 2:95469546-95469568 TTCCACATCCTGATACCCCATGG + Intergenic
934595721 2:95607168-95607190 TTCCACATCCTGATACCCCATGG - Intergenic
934787054 2:97018321-97018343 TTCCACATCCTGATACCCCATGG + Intronic
939865538 2:147468498-147468520 ATCATCATCCTTTCACCACAGGG + Intergenic
942709340 2:178815005-178815027 ATCTTCCTCCTGTCTCCACATGG - Intronic
946006891 2:216533080-216533102 ATCCCCATCCTGTAACCCCGAGG + Intronic
946070388 2:217029829-217029851 CTCCACCTCCTGTCACCAAGTGG + Intergenic
946679966 2:222203233-222203255 ATCCACTTACTTTCACCACAAGG - Intronic
947502345 2:230680609-230680631 AGCTGCATCATGTCACCACAAGG + Intergenic
948161936 2:235831952-235831974 CTCCACATCCTGTCAGCACTTGG + Intronic
948412399 2:237774145-237774167 GTCCCCATCATGTCAGCACAGGG + Intronic
1169790048 20:9400583-9400605 ATCCACATGGTCACACCACAGGG - Intronic
1170737224 20:19022452-19022474 ATGCTCATCCTGTCACCAACTGG - Intergenic
1172491492 20:35342122-35342144 ATGCACCTTCTGTCACCTCATGG - Intronic
1173586761 20:44188046-44188068 GTCCCCTTCCTGTCAACACAGGG + Intergenic
1176377168 21:6092436-6092458 AGGCACATCCTGGCACCACCCGG - Intergenic
1176813135 21:13566740-13566762 ATTAACATCCTTTCACCTCATGG + Intergenic
1179385677 21:40939987-40940009 GTCCAAATTCTGTAACCACAAGG + Intergenic
1179746307 21:43445808-43445830 AGGCACATCCTGGCACCACCCGG + Intergenic
1182070244 22:27458460-27458482 ATTCATATCCTGTCATCACCAGG - Intergenic
1183017349 22:34999962-34999984 ATCCACATCCTGTCTCCTCTTGG - Intergenic
1183302660 22:37065949-37065971 TGCCACCTCCTGCCACCACAGGG + Exonic
1184661712 22:45968469-45968491 GTCCTCATCCTGACTCCACAGGG - Intronic
952497517 3:33928869-33928891 TTCCTCTTCCTGTCACCAGAAGG + Intergenic
956238245 3:67099339-67099361 ATCCATATCCTGTAATCACCCGG - Intergenic
958884104 3:99706971-99706993 ATCCAGATCCTTTCAGAACAAGG - Intronic
959139083 3:102463201-102463223 ATCCACAGCCTTCCTCCACAAGG - Intronic
961641502 3:128367565-128367587 AGCCACATCCTGTTTCCACAAGG + Intronic
962963800 3:140335255-140335277 CTCCACTTCCTGCCACCAAATGG - Intronic
968652187 4:1764702-1764724 ACCCACATCTTGCCCCCACAGGG + Intergenic
968741819 4:2334955-2334977 ATCCACACCCTGACTCCAGACGG - Intronic
968742932 4:2340458-2340480 ATCCACCTGCTGTCCCCTCAGGG + Intronic
972193954 4:36630062-36630084 ATCCACATCCTTTCACAGGAGGG + Intergenic
973205999 4:47560793-47560815 ATCCATATCCTCACACCACCTGG - Intronic
983202033 4:164871705-164871727 AGCCACATTCTGTCTCCACCAGG + Intergenic
983635093 4:169889774-169889796 ATTCACACCATGTTACCACATGG - Intergenic
986238331 5:5933592-5933614 CTCCACATCCAGTCCCCAGATGG + Intergenic
986348699 5:6857439-6857461 ATCCACATCCTGACACCTGCAGG - Intergenic
990988488 5:61662310-61662332 ATCCTCTTCCTGTGACCGCAGGG - Intronic
991392767 5:66166179-66166201 CACCACATCCTGTCAACATATGG - Intronic
994066167 5:95545235-95545257 ATCCACAACCTGTCCCCACTTGG + Intronic
998629723 5:143884652-143884674 ATCCTCATTCTGTCATCCCAGGG + Intergenic
1000980992 5:167816519-167816541 ATCCACTTCCTGTTTCCACAGGG - Intronic
1002340623 5:178514573-178514595 GTCCACATCCTGAAGCCACAGGG + Intronic
1002564276 5:180101105-180101127 ACCCACAGTCTGTCACCACGTGG - Exonic
1004466399 6:15889289-15889311 ATCCTCACTCTGTCTCCACAGGG + Intergenic
1007581337 6:42962038-42962060 ATCTGTTTCCTGTCACCACAAGG - Intronic
1008047063 6:46862174-46862196 TTCCAAATCCTCTCACCACTGGG - Intronic
1008384728 6:50875780-50875802 TTCCACACCCTGTCCCGACAAGG - Intergenic
1012352029 6:98263751-98263773 TACAAAATCCTGTCACCACAGGG + Intergenic
1013220251 6:108071828-108071850 ATCCACTTCCTTTCACATCAGGG + Intronic
1017912254 6:158803788-158803810 ACCCACATCCTGTCAGACCAAGG + Intronic
1018809457 6:167287341-167287363 ATCCACACCCCATCTCCACACGG - Intronic
1018829555 6:167432930-167432952 ATCCACACTCTGCCACCCCATGG - Intergenic
1018829680 6:167433460-167433482 ATCCACACTCTGCCACCCCACGG - Intergenic
1021828208 7:24574367-24574389 ATCCACATCCTGTCACCACACGG - Intronic
1028269520 7:88771110-88771132 ATCTACATCCTGTATCCAGAGGG + Intronic
1031252048 7:119396674-119396696 ATTCACATCATGTCTCCAAATGG - Intergenic
1033781315 7:144672827-144672849 ATACACATCTTCTCCCCACATGG + Intronic
1038431965 8:27507573-27507595 ACCCTCATCCTGTGAGCACAGGG + Intronic
1039135734 8:34321015-34321037 AACCACAGCCTATAACCACAAGG - Intergenic
1040551219 8:48439052-48439074 AGCCATATCCTGTTCCCACAGGG - Intergenic
1043633996 8:82368192-82368214 ATCCTCATCCTCTCCCCACCTGG + Intergenic
1046168175 8:110467882-110467904 ATTTACATACTGTCAGCACAAGG - Intergenic
1049991960 9:999171-999193 ATTCACATCCTCCCACCCCACGG + Intergenic
1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG + Intergenic
1053171571 9:35890187-35890209 AACCACATTCTCTGACCACAAGG - Intergenic
1056090807 9:83203789-83203811 ATGCACTTCCTCTCACCCCAGGG - Intergenic
1056691242 9:88810509-88810531 ATCCACAGCCTGTCTCCACGTGG - Intergenic
1061232931 9:129325406-129325428 ATCCACAGACTGTGAACACATGG + Intergenic
1185911958 X:3989683-3989705 ATTCACATCCTGCCCCCATAGGG + Intergenic
1186470339 X:9816542-9816564 AACCACAAACTGCCACCACAAGG - Intronic
1187111139 X:16301969-16301991 ATCCACCTCCTGTCAGCACCAGG + Intergenic
1191615685 X:63167409-63167431 ATCCACTTCCAGCCACCACAGGG + Intergenic
1191620613 X:63211514-63211536 ATCCACTTCCAGCCACCACAGGG - Intergenic
1199692021 X:150315760-150315782 CTCCAAGTCATGTCACCACATGG - Intergenic
1199954945 X:152735104-152735126 AGCCACATCCTGTCACTCCCAGG - Intronic