ID: 1021830709

View in Genome Browser
Species Human (GRCh38)
Location 7:24605019-24605041
Sequence GGGTGCTGAAAATTGCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021830709 Original CRISPR GGGTGCTGAAAATTGCCCAA AGG (reversed) Intronic
900854613 1:5170936-5170958 GGGTGCTGGACTTGGCCCAATGG - Intergenic
903439590 1:23377710-23377732 GACTACTGAAAATTGCCCCAAGG + Intergenic
903920030 1:26793399-26793421 GGGGGCTGAAAACTGACCACTGG - Intronic
904332959 1:29776727-29776749 GGGTGCTGGATTTTGCCAAATGG + Intergenic
906524975 1:46488644-46488666 TTGAGCTGAAAATTGCACAAGGG + Intergenic
906821537 1:48935325-48935347 GGGTGGGGTAAATTGTCCAATGG + Intronic
913313835 1:117533259-117533281 GGATTCTGGAAATTGACCAAAGG - Intergenic
921049678 1:211502050-211502072 GGCTGCTGGAAATTGCCAGAAGG + Intergenic
922200348 1:223395187-223395209 GGGTGCAGCACATTTCCCAAGGG + Exonic
924328308 1:242917829-242917851 GCTTTCTGAAATTTGCCCAAGGG - Intergenic
1064103406 10:12481878-12481900 GGCTGCTTGTAATTGCCCAATGG - Intronic
1064612730 10:17120115-17120137 GTGTGCTGAAATTTCCCAAAGGG + Intronic
1071140254 10:82501318-82501340 CGGTGCTGAAAATATCCTAAGGG - Intronic
1073530346 10:104225445-104225467 GGATGCTGAAACTTACCAAAGGG + Exonic
1073923932 10:108491876-108491898 GGGCTCTGAAAATTAACCAAAGG + Intergenic
1074722063 10:116272360-116272382 CGGTGTTGGAAATTCCCCAAAGG - Intronic
1075619578 10:123915922-123915944 AGGAGCAGAAAATTGCTCAAGGG - Intronic
1076446525 10:130517966-130517988 GGCAGCTGAAAAGTGGCCAAGGG + Intergenic
1077281946 11:1749787-1749809 GGGTGCTGAAACTTACCGGAAGG - Intronic
1080480523 11:32644736-32644758 GGGTGCTGCAAAGTGGCCCAAGG - Intronic
1081951251 11:47045354-47045376 GGTTGCTGAAAACTTACCAAAGG - Intronic
1087160099 11:94940435-94940457 GGGGGCTGAGAATTGACCATTGG - Intergenic
1089441973 11:118525026-118525048 GTGTGCTGAAAATTTGGCAATGG - Exonic
1090771960 11:129928720-129928742 GTGGGCAGAAAATTGTCCAAAGG - Intronic
1092102503 12:5897292-5897314 CTGTGCTGAATATTGCTCAAGGG + Intronic
1095175725 12:39090057-39090079 AGGTGCTGAGAATTGACCACTGG - Intergenic
1095921894 12:47540213-47540235 GGGTGAGGAAACCTGCCCAAGGG + Intergenic
1096228107 12:49882195-49882217 CTGTGCTGAGAATTCCCCAAAGG + Intronic
1098406888 12:70136164-70136186 GGATGCTGAATTTTGCCAAATGG - Intergenic
1098762817 12:74446621-74446643 CGGTGGTGATAGTTGCCCAAAGG - Intergenic
1099748398 12:86737260-86737282 GAGTACTGAAAATTGACCATTGG - Intronic
1103980649 12:124734845-124734867 TTGTGCTGTAAATTGCCCAGTGG - Intergenic
1109848734 13:68033010-68033032 GGTAGGTGAAAATTGCCAAAGGG + Intergenic
1110949938 13:81473566-81473588 GTGTTCTCAAAATGGCCCAAAGG + Intergenic
1115034046 14:28835989-28836011 GGCTGGAGAAAATTGCCCATGGG + Intergenic
1120750349 14:88191704-88191726 GGGAGCTGAGAACTGCCCAGAGG - Intronic
1121659353 14:95623434-95623456 TGGTGCTGAAAATTCTTCAAGGG + Intergenic
1126370275 15:47938591-47938613 GAGTGCTGGAAATTGACCATTGG + Intergenic
1127486641 15:59424161-59424183 GGCTGCTGAAAAGTTCCAAAAGG - Intronic
1130921182 15:88346089-88346111 CAGAGCTGAAAATTGCCCATTGG - Intergenic
1134388903 16:13800426-13800448 AGATGCTGAATATTACCCAAAGG - Intergenic
1134441383 16:14301647-14301669 GGGTGCTGAAAATTGGGGGAAGG + Intergenic
1134818173 16:17223311-17223333 GGGGGCTGGAAATAACCCAAAGG + Intronic
1135294163 16:21264824-21264846 GGGAGCTGAGAATGGCCCCAAGG + Intronic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1137821004 16:51445947-51445969 GGGTACTCAATGTTGCCCAAAGG + Intergenic
1140724125 16:77796995-77797017 GAGGGTTGAAAATTGCCTAATGG + Intronic
1140863525 16:79040022-79040044 GGGTGATGCTAATTGCCCAAGGG - Intronic
1143283196 17:5770170-5770192 GGGTGCTGATTATTTGCCAAAGG - Intergenic
1143591308 17:7887000-7887022 GGGAGATAAAAATTGCCCAGGGG - Intronic
1148041312 17:44709393-44709415 GTGAGGTGAAAATTGCCCCAGGG + Intronic
1149130822 17:53299701-53299723 GGATGCTGAACATTGTCAAATGG - Intergenic
1150944771 17:69733093-69733115 TGGTGCTGAAAATTGTCCACGGG - Intergenic
1151835265 17:76578717-76578739 GGGTGCTCAAAACTGCCACAGGG + Intronic
1154361817 18:13669291-13669313 GGATGCTTAAAATTGTCCAGTGG + Intronic
1157581674 18:48777378-48777400 GGGGTCTGAAAATTGCACATAGG - Intronic
1159445396 18:68536249-68536271 GGATGATGAAAATTGGCTAACGG - Intergenic
1161527199 19:4763753-4763775 GGGTGATGATGATGGCCCAATGG - Intergenic
1163699387 19:18779721-18779743 GGATGCTGAAAATGGGCCACGGG - Exonic
1164588981 19:29495812-29495834 GGGTTCAGAAACTTGCCCAAGGG + Intergenic
925650382 2:6083262-6083284 GGATACTGAAAATTTGCCAAGGG - Intergenic
925757811 2:7150673-7150695 GGGAACTGACAATTGCCTAATGG - Intergenic
925853177 2:8104102-8104124 GCTTGCTGGAAATTGCCCATTGG - Intergenic
928564256 2:32527489-32527511 GGGTGCAGAAAATTTTCAAAAGG + Intronic
928698080 2:33870897-33870919 GGGTTCTGGAAATTGATCAAAGG - Intergenic
929804135 2:45129755-45129777 GAGGACTGAAAATTGACCAATGG - Intergenic
935659192 2:105450946-105450968 AGATGCTGAAACTTACCCAACGG + Intergenic
937752163 2:125489338-125489360 AAGTACTGAAAATTGCCCCAGGG - Intergenic
944889173 2:204098982-204099004 GGGTTCTGAAATTTTCACAAAGG + Intergenic
945803905 2:214466596-214466618 GGATGCTTAAAATTGTCCCATGG + Intronic
945974593 2:216260365-216260387 AGGTGCTGACAATTGCCTTAAGG + Intronic
947365808 2:229393899-229393921 GACTGCTTAAAATTGTCCAATGG - Intronic
947474621 2:230431504-230431526 GGGTTCTGAAATTTTCACAAAGG + Intronic
947634806 2:231674553-231674575 GGGGGCTGAGATTTGCCCAATGG + Intergenic
947815434 2:233033536-233033558 CTGTGCTTAGAATTGCCCAATGG + Intronic
1172071629 20:32261607-32261629 GGGAGCTGAAAATCCCCAAAAGG - Intergenic
1173143171 20:40502596-40502618 GGGGGCTGAAACTGGCCCAATGG - Intergenic
1173986122 20:47262892-47262914 GGGAGCTGGAGATTTCCCAAGGG - Intronic
1177143612 21:17383963-17383985 GGGTGGTGAATATTACCCACTGG + Intergenic
1178191095 21:30282127-30282149 AGCAGCTGGAAATTGCCCAATGG - Exonic
1181541731 22:23576811-23576833 TGGTGGTGAAGGTTGCCCAACGG - Intronic
1184192794 22:42906071-42906093 CAGTGCTGAAAACTGTCCAAGGG + Intronic
952610784 3:35206416-35206438 GGGTCCTGAAAATTCCTCATGGG + Intergenic
956374532 3:68600317-68600339 GGGTGCTCAGAACTGCACAAAGG + Intergenic
956699231 3:71944172-71944194 TGGTGCTGGATATTGGCCAAAGG + Intergenic
967992453 3:195141661-195141683 GGGTTCTGAGATTTGCTCAAAGG - Intronic
969669028 4:8579671-8579693 CGGTGCTGCAAAGTGGCCAAGGG - Intronic
971035064 4:22684226-22684248 GGGTCCTCTGAATTGCCCAATGG - Intergenic
974412358 4:61557959-61557981 GGTTGCTGTAAGTTGCACAATGG - Intronic
978907289 4:114021701-114021723 GTGTCTTGAAAATGGCCCAAAGG - Intergenic
982090891 4:151879117-151879139 GGCTGCTGCAGATTGACCAAAGG + Intergenic
985047697 4:185957134-185957156 GGGTATTGAAAAGTCCCCAATGG + Intergenic
986327251 5:6685338-6685360 GGATTCTCAAAATTGCCCAAGGG - Intergenic
987187127 5:15434046-15434068 GGATTCTGAAATTTGCACAAAGG + Intergenic
988504502 5:31810126-31810148 GATTGCTGAAAATGGCCCAGGGG - Intronic
994702293 5:103150398-103150420 GGGTGAAGAAAATGGCCAAAAGG - Intronic
995594711 5:113735373-113735395 GGGCACTGGAAATTGACCAAAGG + Intergenic
999192435 5:149758218-149758240 GAGTGGTGAGACTTGCCCAAAGG - Intronic
1002783991 6:387378-387400 GTTTTCAGAAAATTGCCCAAAGG + Intergenic
1006188703 6:32194987-32195009 AGGTGCTGAAAAGTGGCCAAGGG - Exonic
1007090615 6:39182337-39182359 GGTAGCTAAAAATTGCCCATAGG - Intergenic
1009907269 6:69885163-69885185 GGGTACTGAAAAGAGCCAAAGGG - Intronic
1009938787 6:70265278-70265300 GGGGAGTGAAAATTCCCCAAAGG + Intronic
1012201661 6:96413762-96413784 GGCTGCTGAAAATCAGCCAAAGG - Intergenic
1012705671 6:102525851-102525873 AGATGCTAAAAATTGCCCCATGG - Intergenic
1015158926 6:130129617-130129639 CTGTGATGAAAATTGACCAAAGG - Intronic
1018089478 6:160333376-160333398 GGGTAGTGGAGATTGCCCAAGGG + Intergenic
1018853023 6:167654873-167654895 GGGTGCTGGAAAATGCCTAGTGG + Intergenic
1021171407 7:17402216-17402238 TGGTGCAGAAAGTTGCCAAAAGG + Intergenic
1021830709 7:24605019-24605041 GGGTGCTGAAAATTGCCCAAAGG - Intronic
1026735384 7:72945655-72945677 GGGTGCTGAGGATGCCCCAAAGG - Exonic
1026785724 7:73300585-73300607 GGGTGCTGAGGATGCCCCAAAGG - Intergenic
1027108341 7:75419351-75419373 GGGTGCTGAAGATGCCCCAAAGG + Exonic
1030989618 7:116284309-116284331 GGGTGGTGAAAGTTGACCAGAGG + Intergenic
1032685295 7:134226902-134226924 GGATGCTGATGATCGCCCAAAGG - Intronic
1033888706 7:145980629-145980651 GGAAGCTGAAATTTCCCCAAAGG + Intergenic
1034431665 7:151044139-151044161 CGGTGCTGGTAATTGCCCACCGG + Exonic
1036686329 8:10914036-10914058 GGGGTCTGGAATTTGCCCAAGGG - Intronic
1040750702 8:50702615-50702637 GTGTACTGAAAATTGTCAAAGGG - Intronic
1041697202 8:60748468-60748490 GGGTGCTGCAAAGAGCCCCATGG - Intronic
1042070038 8:64922722-64922744 GGCTGCTGAATATTGTCAAATGG + Intergenic
1042294555 8:67205245-67205267 GGAGGCAGACAATTGCCCAAAGG - Intronic
1055391697 9:75828625-75828647 GGAATCTGAAAATAGCCCAAAGG + Intergenic
1056577457 9:87867432-87867454 GGGTGATGAAGCTTGCCCAGTGG + Intergenic
1057562542 9:96139880-96139902 GGGTGCTGGCAAATTCCCAAGGG - Intergenic
1060966858 9:127716454-127716476 GGGTCCTGAAGGTTACCCAAGGG + Exonic
1061202724 9:129146857-129146879 GGCTGCTGGGAATTGCCCAGGGG + Intronic
1186975891 X:14904543-14904565 AGGTGCTCAAAATTGCCCTTAGG + Intronic
1187956583 X:24524659-24524681 GGATGCTGTAAATTGCCTATAGG - Intronic
1189528198 X:41848940-41848962 GGGCTCTGGAAATTGACCAAAGG - Intronic
1194750724 X:97681309-97681331 GGAAGCTGAAATTTGCCAAATGG - Intergenic
1197630416 X:128852155-128852177 GGGTTCTGAAATTTTCACAAAGG - Intergenic
1199807222 X:151312241-151312263 GAGTGCACAAAAGTGCCCAATGG - Intergenic
1201225695 Y:11816785-11816807 GCTTTCTGAAATTTGCCCAAGGG - Intergenic
1201945308 Y:19504229-19504251 GGGTGCTAAAAAATAACCAAGGG + Intergenic