ID: 1021834280

View in Genome Browser
Species Human (GRCh38)
Location 7:24652649-24652671
Sequence CCCATGGTTTGCAGATGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021834280_1021834284 0 Left 1021834280 7:24652649-24652671 CCAGGGCATCTGCAAACCATGGG No data
Right 1021834284 7:24652672-24652694 CATCCTACTGAGATGCTATAGGG No data
1021834280_1021834287 9 Left 1021834280 7:24652649-24652671 CCAGGGCATCTGCAAACCATGGG No data
Right 1021834287 7:24652681-24652703 GAGATGCTATAGGGAAGCAAGGG No data
1021834280_1021834286 8 Left 1021834280 7:24652649-24652671 CCAGGGCATCTGCAAACCATGGG No data
Right 1021834286 7:24652680-24652702 TGAGATGCTATAGGGAAGCAAGG No data
1021834280_1021834283 -1 Left 1021834280 7:24652649-24652671 CCAGGGCATCTGCAAACCATGGG No data
Right 1021834283 7:24652671-24652693 GCATCCTACTGAGATGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021834280 Original CRISPR CCCATGGTTTGCAGATGCCC TGG (reversed) Intronic