ID: 1021834283

View in Genome Browser
Species Human (GRCh38)
Location 7:24652671-24652693
Sequence GCATCCTACTGAGATGCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021834280_1021834283 -1 Left 1021834280 7:24652649-24652671 CCAGGGCATCTGCAAACCATGGG No data
Right 1021834283 7:24652671-24652693 GCATCCTACTGAGATGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021834283 Original CRISPR GCATCCTACTGAGATGCTAT AGG Intronic