ID: 1021838862

View in Genome Browser
Species Human (GRCh38)
Location 7:24706304-24706326
Sequence GCTGAAGCCCCGGCAGCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 377}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021838862_1021838873 19 Left 1021838862 7:24706304-24706326 CCTGCTGCTGCCGGGGCTTCAGC 0: 1
1: 0
2: 2
3: 39
4: 377
Right 1021838873 7:24706346-24706368 TGGGCGAGAGGCCGCTGACCAGG 0: 1
1: 0
2: 0
3: 15
4: 121
1021838862_1021838865 0 Left 1021838862 7:24706304-24706326 CCTGCTGCTGCCGGGGCTTCAGC 0: 1
1: 0
2: 2
3: 39
4: 377
Right 1021838865 7:24706327-24706349 TCCCCCAGCACCGCCACTGTGGG 0: 1
1: 0
2: 1
3: 26
4: 216
1021838862_1021838870 7 Left 1021838862 7:24706304-24706326 CCTGCTGCTGCCGGGGCTTCAGC 0: 1
1: 0
2: 2
3: 39
4: 377
Right 1021838870 7:24706334-24706356 GCACCGCCACTGTGGGCGAGAGG 0: 1
1: 0
2: 2
3: 10
4: 92
1021838862_1021838864 -1 Left 1021838862 7:24706304-24706326 CCTGCTGCTGCCGGGGCTTCAGC 0: 1
1: 0
2: 2
3: 39
4: 377
Right 1021838864 7:24706326-24706348 CTCCCCCAGCACCGCCACTGTGG 0: 1
1: 0
2: 0
3: 38
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021838862 Original CRISPR GCTGAAGCCCCGGCAGCAGC AGG (reversed) Exonic
900204499 1:1426274-1426296 GCAGGAGCCCGGCCAGCAGCCGG - Exonic
900227640 1:1540473-1540495 GCTGCAACCCCGGCACCGGCCGG + Intergenic
900500137 1:3000346-3000368 GCTGTAGACTTGGCAGCAGCAGG + Intergenic
900597709 1:3490047-3490069 GCTGCAGCCCTGGGATCAGCTGG - Exonic
900710320 1:4109259-4109281 GCTCATTACCCGGCAGCAGCAGG + Intergenic
900844638 1:5087065-5087087 GCTGAAGCTCCTTCAGCGGCAGG - Intergenic
901014165 1:6218226-6218248 GCTTAAGGCCGTGCAGCAGCTGG + Intronic
901971436 1:12912075-12912097 GCAGAAGCCCAGGGAGGAGCTGG + Intronic
902013732 1:13289665-13289687 GCAGAAGCCCAGGGAGGAGCTGG - Intergenic
902234225 1:15047468-15047490 GCAGAAGCCACGGCAGCTGCAGG + Intronic
902467249 1:16625963-16625985 GCTGCAGGGCCGGCAGCGGCAGG - Intergenic
902992251 1:20196455-20196477 GCTGAGGCCCAGGCCTCAGCTGG - Intergenic
903543272 1:24108546-24108568 GCTGGAGCACCGGCAGGAGGAGG - Exonic
903950591 1:26993949-26993971 GCTGAAGCCCCAGCTGCGTCCGG - Exonic
904236974 1:29122594-29122616 GCTGGGGCCACGGCAGCAGGCGG + Intronic
905243352 1:36595709-36595731 GCTGCAGCCCCCGCTGCAGGAGG + Intergenic
905717101 1:40161445-40161467 GCTGAGGCTCCGGCGGTAGCGGG + Exonic
905872697 1:41414313-41414335 GCTGCAGCCCCAGGAGCAGGAGG + Intergenic
906627098 1:47334116-47334138 GGTGAGGCCCGGGCAGCAGGCGG + Exonic
907244852 1:53102282-53102304 GCTGTAGCCACGGCAGCGGTGGG + Intronic
908035257 1:60044627-60044649 TCTGAAGCCCAGCCTGCAGCTGG - Intronic
910291323 1:85602906-85602928 GCTGCAACACCAGCAGCAGCAGG - Intergenic
912149519 1:106840327-106840349 GAGGAAGCCACGGCAGCAGAAGG - Intergenic
912248555 1:107987568-107987590 GCTGAAGACCTGGGAGCACCTGG + Intergenic
912557960 1:110529882-110529904 TCTGAATCCCAGGCACCAGCTGG - Intergenic
912715127 1:111978062-111978084 CCTCAAGCCCTGACAGCAGCTGG + Intronic
914939142 1:152006833-152006855 GCTGAGGCCCCCCCTGCAGCGGG + Intergenic
915034406 1:152910313-152910335 GCTGAAGCACCCGGAGCAGCAGG + Exonic
915034448 1:152910493-152910515 GCTGGAGCTCCCACAGCAGCAGG + Exonic
915034464 1:152910583-152910605 GCTGAAGCACCTGGAGCACCAGG + Exonic
915034485 1:152910673-152910695 GCTGAAGCACCTGGATCAGCAGG + Exonic
915034494 1:152910733-152910755 GCTGAAGCACCTGGAGCAGCAGG + Exonic
915034513 1:152910823-152910845 GCTGAAGCACCTGGAGCAGCAGG + Exonic
915034544 1:152910973-152910995 GCTGAAGCACCTGGTGCAGCAGG + Exonic
915128000 1:153679159-153679181 GCAGCAGCGGCGGCAGCAGCAGG - Exonic
915605423 1:156947346-156947368 CCTGATGCCCCGGGAGGAGCTGG - Exonic
919730980 1:200913410-200913432 GCAGAAGCAGCAGCAGCAGCAGG - Intronic
921850423 1:219927966-219927988 CCTGCAGCAGCGGCAGCAGCTGG - Exonic
922793084 1:228321367-228321389 TGTGAAGCCACAGCAGCAGCAGG + Exonic
923119674 1:230978635-230978657 GCTGCAGCACCGGCAGCAGCAGG - Exonic
924653136 1:245948715-245948737 GCTTCAGCCCTGGCAGCAGCAGG - Intronic
924707964 1:246513444-246513466 GCTGAAGCCCAGCCAGCTGGAGG + Intergenic
1067147416 10:43703432-43703454 CCCGAGGCCCAGGCAGCAGCTGG + Intergenic
1067299111 10:44993293-44993315 GCTGCAGCGCCTGGAGCAGCTGG + Exonic
1069021376 10:63492146-63492168 GCCTCAGCCCCGGAAGCAGCTGG + Intergenic
1069844891 10:71364122-71364144 ACTAAAGCCCAGCCAGCAGCAGG + Intergenic
1069923045 10:71828990-71829012 GCTGAATCACCAGAAGCAGCTGG - Exonic
1070544912 10:77444753-77444775 GCTGAGTCCCAGGGAGCAGCTGG + Intronic
1070791974 10:79195062-79195084 GCTGAAGGCCCGGCAGCCCCGGG - Intronic
1071857872 10:89644687-89644709 GCTGCAGCTCCGGCAGGAGCGGG + Exonic
1072439132 10:95438471-95438493 GCGGAAGCCCAGGCACCAGGTGG - Intronic
1072448395 10:95519244-95519266 GCTGAAGCCTGGCCAGCACCAGG - Intronic
1072533230 10:96339127-96339149 GCTGAAGACACGGAAGCAGCTGG - Intergenic
1073472399 10:103731059-103731081 GCTGAGGCCCCAGCAGCACTTGG + Intronic
1073875319 10:107915126-107915148 GCTGAGGCCCCGGCAGCTCCCGG - Intergenic
1074026637 10:109642579-109642601 GAGAAAGCCCCAGCAGCAGCAGG + Intergenic
1075091084 10:119444506-119444528 GCTGAGAGCCAGGCAGCAGCAGG - Intronic
1075212241 10:120501048-120501070 GCTGGAACCCTGGCAGGAGCTGG - Intronic
1075948721 10:126459433-126459455 GCCGAGGCCCCTGCTGCAGCAGG + Intronic
1076768916 10:132652354-132652376 GCTGCAGCCCCAGGAGGAGCGGG + Intronic
1077252197 11:1565643-1565665 GGTGAAGCGGCGGCTGCAGCAGG - Exonic
1077423835 11:2465321-2465343 CCTGAGGCCCTGGCTGCAGCTGG + Intronic
1078107460 11:8367516-8367538 GCTGAAGTTCAGGCAGCATCAGG - Intergenic
1083168431 11:60906463-60906485 GGAGCAGTCCCGGCAGCAGCGGG - Exonic
1083615574 11:64024523-64024545 GGGGAGGCCCAGGCAGCAGCTGG - Intronic
1083636874 11:64125558-64125580 GCTCCTGCCCCGCCAGCAGCTGG + Intronic
1083745601 11:64735046-64735068 ACTGAAGCCCAGGCAGAAGTGGG + Intronic
1084000848 11:66294657-66294679 GCTGATCCGCCGGCTGCAGCAGG + Exonic
1084021323 11:66420004-66420026 GCCGCAGCCGCGGCAGCCGCCGG + Intergenic
1084302093 11:68258614-68258636 GCCCAAGGCCGGGCAGCAGCTGG + Intergenic
1084316978 11:68351290-68351312 GCTGGCTCCCCGGCAGCTGCAGG - Intronic
1084356059 11:68639464-68639486 GCTTCAGCCCCGGGAGTAGCTGG - Intergenic
1084416493 11:69035740-69035762 GGTGAAGCCCCAGGAGAAGCAGG - Intergenic
1084680172 11:70662361-70662383 GATGACGCCCAGGCAGCCGCCGG - Intronic
1085315339 11:75541473-75541495 GCTGGAGCCCAGGCAGCAGATGG - Intergenic
1085328510 11:75627280-75627302 GCTGATGGTCCAGCAGCAGCTGG + Intronic
1087082363 11:94183882-94183904 GTAGAAGCCTGGGCAGCAGCAGG + Intergenic
1087820062 11:102701706-102701728 GCTGAGGTTCAGGCAGCAGCAGG - Intronic
1089282901 11:117386889-117386911 GCTCAAGAGCTGGCAGCAGCAGG - Intronic
1089755173 11:120681124-120681146 GCTAAAGCCCTGGCAGCCACTGG - Intronic
1091399071 12:171894-171916 GCAGAAGACCCAGCAGCAGCTGG + Intronic
1091795261 12:3294388-3294410 CCCAGAGCCCCGGCAGCAGCAGG + Intergenic
1091836233 12:3588063-3588085 GCAGGAGCCCCAGCAGAAGCAGG + Intronic
1091965366 12:4736209-4736231 GCTGAAGCCCCACCAGCACTAGG + Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1095038458 12:37419246-37419268 GCTGCCGCCTCGGCTGCAGCAGG - Intergenic
1095038459 12:37419249-37419271 GCTGCAGCCGAGGCGGCAGCTGG + Intergenic
1095049498 12:37543693-37543715 GCTGCAGCCTCCGCGGCAGCTGG - Intergenic
1095946679 12:47757895-47757917 GCTGGTGCTCCAGCAGCAGCTGG + Exonic
1096365640 12:51026445-51026467 GCTGGAGTCCCTGCAGCGGCCGG + Intronic
1096466034 12:51848249-51848271 GCTGCAGCCCCCGCACCAGAGGG + Intergenic
1097041318 12:56157831-56157853 GCTGGAGCCCGTGCAGCAACCGG - Exonic
1097247513 12:57614685-57614707 CCAGGAGCTCCGGCAGCAGCTGG + Exonic
1101803221 12:108040816-108040838 TCTGAAGCCCCGGTGGCTGCAGG + Intergenic
1103718409 12:122959995-122960017 GCTGGGGCCCCGGCGGCTGCGGG - Exonic
1103920580 12:124397166-124397188 GCTGAGGCCGGGGCAGCACCTGG - Intronic
1104605273 12:130183553-130183575 GCTGCAGCCCCACCTGCAGCTGG + Intergenic
1104929041 12:132328797-132328819 GCGGAAGCCCCTTCAGCAGCGGG - Intronic
1105930353 13:25046878-25046900 GCGGCGGCCCCGGCAGCTGCAGG - Intergenic
1106165948 13:27246586-27246608 GCTTCAGCCCCGCAAGCAGCTGG + Intergenic
1107513475 13:41107489-41107511 GCTGCAGCACCCGCAGCTGCAGG + Intergenic
1107978731 13:45714240-45714262 GCTGAAGCTGCAGCAGAAGCTGG + Exonic
1110746100 13:79054943-79054965 GCTGCAGGCCTGGCAACAGCAGG + Intergenic
1113382313 13:109814882-109814904 GCTGTGGCCCCTTCAGCAGCAGG + Intergenic
1113638731 13:111942216-111942238 ACTGCAGCCTGGGCAGCAGCAGG - Intergenic
1114537085 14:23429796-23429818 GCTGAAGCAGCGGGAGGAGCAGG - Exonic
1117913019 14:60652441-60652463 GCTGCAGCGAGGGCAGCAGCCGG - Intronic
1119067363 14:71542392-71542414 GCAGAAGCAGCAGCAGCAGCAGG - Intronic
1119067364 14:71542423-71542445 GCAGAAGCAGCAGCAGCAGCAGG - Intronic
1119067365 14:71542454-71542476 GCAGAAGCAGCAGCAGCAGCAGG - Intronic
1120742324 14:88121682-88121704 GCTGAAGCCACAGCAACAGCTGG - Intergenic
1121387391 14:93540705-93540727 GCTGAACCGGCGGCGGCAGCTGG + Exonic
1121908432 14:97768241-97768263 GAAGAAGCCTCTGCAGCAGCAGG - Intergenic
1122125266 14:99575330-99575352 GCTGAGGCCCTGGCGGCAGGGGG - Intronic
1122268563 14:100558028-100558050 GCTGGAGCCCCACCTGCAGCTGG - Intronic
1122976396 14:105172642-105172664 GCTGCAGCCCCGTGACCAGCAGG + Intergenic
1123061992 14:105598579-105598601 GCTGATGACCCGGGACCAGCAGG - Intergenic
1123086735 14:105720310-105720332 GCTGATGACCCGGGACCAGCAGG - Intergenic
1124971184 15:34490700-34490722 GCTGGAGCAGAGGCAGCAGCGGG - Intergenic
1125932746 15:43611955-43611977 GCTGAGCCCCCGGGAGCTGCGGG - Exonic
1125945845 15:43711417-43711439 GCTGAGCCCCCGGGAGCTGCGGG - Intergenic
1126679949 15:51192943-51192965 ACGGAAGCCCAAGCAGCAGCCGG - Intergenic
1130547094 15:84864554-84864576 GCTGAGGCTCCGACAGCATCTGG + Exonic
1131262645 15:90895715-90895737 GAGGAAGCCCTGGCAGCAGCAGG - Exonic
1132115232 15:99131186-99131208 CAAGGAGCCCCGGCAGCAGCTGG + Exonic
1132743902 16:1428856-1428878 CCTGAACCCCAGGCAGCCGCAGG + Intergenic
1132745294 16:1433834-1433856 CCTGAGCCCCCGGCAGCAGACGG + Intergenic
1132894779 16:2223656-2223678 GCAGAAGCCCAGGCCGAAGCCGG + Exonic
1133035432 16:3031412-3031434 CCAGAAGCCCCGGCAGCAGCTGG - Intronic
1133062556 16:3184042-3184064 ACTGACGCCCTGCCAGCAGCAGG + Intergenic
1133262193 16:4558177-4558199 GCTGAAGGCCCAGCAGCTGGTGG + Intronic
1133287339 16:4696767-4696789 GATCAGGCCCCGGGAGCAGCCGG - Exonic
1134055336 16:11166460-11166482 GCGGGAGCCCCAGCGGCAGCGGG + Exonic
1135089305 16:19500175-19500197 GTAGAAGCCCAAGCAGCAGCCGG - Intergenic
1135303487 16:21350156-21350178 CCTGCAGCACAGGCAGCAGCAGG + Intergenic
1135976162 16:27109990-27110012 TCTGCAGCCCCGGCATCCGCTGG + Intergenic
1136300234 16:29329350-29329372 CCTGCAGCACAGGCAGCAGCAGG + Intergenic
1136414739 16:30096221-30096243 GCCGCAGCGGCGGCAGCAGCTGG - Intronic
1137440784 16:48497168-48497190 TCTGAAGCTGGGGCAGCAGCCGG - Intergenic
1137775013 16:51047212-51047234 GCAGAAGCAGCAGCAGCAGCTGG + Intergenic
1137958064 16:52852969-52852991 ACTTAAGCCCCAGTAGCAGCTGG + Intergenic
1138396572 16:56709227-56709249 GCTCAAGCTCAGGCTGCAGCTGG + Intronic
1139440481 16:66964165-66964187 GCTGAAGCCCAGGTTCCAGCAGG + Intronic
1139576915 16:67847470-67847492 GCCCAAGCCCCGGCTGCGGCAGG - Intronic
1142026435 16:87816609-87816631 GCTGGAGCACCGGCAGCTTCAGG + Intergenic
1142061964 16:88036114-88036136 CCTGCAGCACAGGCAGCAGCAGG + Intronic
1142434401 16:90047558-90047580 GCTGGAGCCTCAGCAGCCGCGGG + Intergenic
1142480116 17:213877-213899 GCTGGAGCTGCGTCAGCAGCGGG + Exonic
1143736731 17:8916455-8916477 GCGGCATTCCCGGCAGCAGCTGG - Intronic
1144109866 17:12021094-12021116 GAGGAAGCCACGGCAGCCGCCGG + Intronic
1145269842 17:21398998-21399020 GGTGGAGCCCTGGCAGGAGCTGG + Intronic
1145307070 17:21681277-21681299 GCTGCAGCCGCGGTAGCGGCTGG + Intergenic
1145379006 17:22376854-22376876 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145379007 17:22376857-22376879 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145379484 17:22379224-22379246 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145379485 17:22379227-22379249 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145379963 17:22381594-22381616 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145379964 17:22381597-22381619 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145380444 17:22383969-22383991 GCTGCAGCCGCGGCTGCCGCTGG - Intergenic
1145380445 17:22383972-22383994 GCGGCAGCCGCGGCTGCAGCAGG + Intergenic
1145380921 17:22386316-22386338 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145380922 17:22386319-22386341 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145381401 17:22388691-22388713 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145381402 17:22388694-22388716 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145382134 17:22392465-22392487 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145382135 17:22392468-22392490 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145382609 17:22394830-22394852 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145382610 17:22394833-22394855 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145382889 17:22396193-22396215 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145382890 17:22396196-22396218 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145383462 17:22399016-22399038 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145383463 17:22399019-22399041 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145383976 17:22401484-22401506 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145383977 17:22401487-22401509 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145384414 17:22403686-22403708 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145384415 17:22403689-22403711 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145384733 17:22405148-22405170 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145384734 17:22405151-22405173 GCCGCAGCCGCGGCTGCAGCAGG + Intergenic
1145813655 17:27780653-27780675 CCTAAAGCCCAGCCAGCAGCAGG - Intronic
1145911802 17:28547457-28547479 CCTGAAGCCCCTGCAGTGGCGGG - Intronic
1146260367 17:31416661-31416683 GCCAGAGCCCCTGCAGCAGCAGG + Intronic
1147218586 17:38915047-38915069 CCAGCAGCCCCAGCAGCAGCCGG + Exonic
1147677739 17:42219361-42219383 GTGGAAGCGGCGGCAGCAGCTGG - Exonic
1147688297 17:42300210-42300232 GTGGAAGCGGCGGCAGCAGCTGG + Exonic
1147818617 17:43228470-43228492 GCTGATGGCCCAGCAGCAGCAGG - Intergenic
1147831900 17:43303172-43303194 GCTGATGGCCCAGCAGCAGCAGG - Intergenic
1148021694 17:44557715-44557737 GCAGCAGCAGCGGCAGCAGCAGG - Exonic
1151332662 17:73420075-73420097 GCTGAGCCCCAGGCAGGAGCAGG + Intronic
1151679422 17:75615740-75615762 GATGCAGCAGCGGCAGCAGCAGG + Intergenic
1151748488 17:76023999-76024021 GGTGAGGCCCCGGCAGCAGTTGG - Exonic
1152586236 17:81190661-81190683 GCTGCAGGCCCGCCAGCAGCTGG - Exonic
1152730125 17:81966060-81966082 ACTGCAGGCCCCGCAGCAGCCGG - Intergenic
1152775854 17:82201578-82201600 GCTGCAGCAGCAGCAGCAGCTGG - Exonic
1152889916 17:82874456-82874478 CCTGAGGCCCCAGCAGCTGCTGG - Intronic
1153770585 18:8412428-8412450 GCTGTAGCCTAGGCAGCAGCAGG + Intergenic
1154104238 18:11506281-11506303 TCTGAAGCCCCTGACGCAGCTGG - Intergenic
1154107444 18:11534563-11534585 GCTGAAGCGCCAGCAGGAGGAGG - Intergenic
1155906939 18:31462986-31463008 GGAGAAGCCCAGGCAGCAGTGGG + Intronic
1156270262 18:35524057-35524079 GTTGAAGCCTTGGTAGCAGCAGG - Intergenic
1159711676 18:71767131-71767153 GCTGAAGGCCCGAGAGCACCTGG - Intronic
1159810045 18:73007473-73007495 GCTGAATCTGCAGCAGCAGCAGG + Intergenic
1160108802 18:76005709-76005731 GCTGAGACTCCAGCAGCAGCAGG - Intergenic
1160116297 18:76082319-76082341 GGTGAAGCCCCATCAGCACCTGG - Intergenic
1160455375 18:78995422-78995444 GGTGAAGGCCCGGCCGCAGATGG - Exonic
1160510677 18:79451836-79451858 GCCGAAGCCCAGGCCGCAGATGG - Intronic
1160698709 19:496517-496539 CCAGAAGCCCCGCCAGCAGGAGG - Exonic
1160792617 19:929555-929577 GCTGTTGCAGCGGCAGCAGCGGG + Exonic
1161057865 19:2199723-2199745 GCTGCAGCCCTGGGAGCTGCAGG - Intronic
1161169905 19:2807458-2807480 GCTGAAGCCCCTGGGGGAGCAGG + Exonic
1161330237 19:3683424-3683446 GCTGGAGCGCAGGCAGGAGCTGG + Intronic
1161400334 19:4064458-4064480 CCTCAGGCCCTGGCAGCAGCAGG + Intronic
1162018415 19:7857798-7857820 GCTGAGGCCCCGGCAGGAGAGGG - Intronic
1162904372 19:13814816-13814838 GCTGATGCCGCTGCTGCAGCCGG - Intronic
1162927565 19:13937964-13937986 GCGGGGGCCCCGGCAACAGCAGG + Exonic
1163797866 19:19347736-19347758 GCTGATGCCCCTGCAGGATCAGG + Intronic
1164365591 19:27578719-27578741 GCTGAAGCCATGGCAGAAGAAGG + Intergenic
1164548079 19:29185656-29185678 GCTGGAGACCCGGCAGGGGCCGG + Intergenic
1165149348 19:33751806-33751828 GCTGAAGCCCCCACGGGAGCGGG + Intronic
1165157850 19:33798547-33798569 GCTGAGGCCCCTGCAACAGGCGG + Exonic
1165601639 19:37059249-37059271 GCTGCAGCCGCGGCGGCGGCTGG - Intronic
1165850915 19:38849900-38849922 GCTGGAGCAGAGGCAGCAGCCGG - Exonic
1166748340 19:45152510-45152532 GCTGCAGCAGCAGCAGCAGCAGG - Exonic
1168293433 19:55368215-55368237 GCTGCAGCCGGCGCAGCAGCCGG + Exonic
1168412000 19:56146190-56146212 GCAGCAGGCCTGGCAGCAGCAGG - Intronic
925296952 2:2783605-2783627 CCTGCAGCCCCTGTAGCAGCTGG + Intergenic
925609861 2:5693486-5693508 GCTGCTGCCCCGGCGGCTGCAGG - Exonic
926563437 2:14443578-14443600 TCTGAAGCCCTGGCAGTTGCTGG - Intergenic
928155850 2:28875760-28875782 TCTGAAGCCCAGACAGGAGCAGG - Intergenic
930321821 2:49864612-49864634 GCTGATGCCCAGGCAGAAGTGGG + Intergenic
931722549 2:65077997-65078019 GCTTAATCCCTGTCAGCAGCAGG + Intronic
932722400 2:74147736-74147758 CCTCAAGCCCCGACAGCCGCCGG + Intronic
933093030 2:78145658-78145680 GCAGCAGCCCCCACAGCAGCGGG - Intergenic
933719932 2:85391340-85391362 TCTGACTCCCTGGCAGCAGCAGG + Exonic
934764803 2:96874720-96874742 CCCGAAGCCCCGGCAGCATCAGG - Intergenic
934856407 2:97732883-97732905 GCTGAGGCCGCGGAAGGAGCAGG + Exonic
935137566 2:100321454-100321476 CCTGCAGCGCCAGCAGCAGCCGG - Exonic
937815970 2:126251241-126251263 GCTGGGCCCCAGGCAGCAGCAGG + Intergenic
938311649 2:130293798-130293820 GCTGCAGCCGCAGCAGCAGAAGG - Intergenic
938480373 2:131657769-131657791 GCTGCAGTCCGGGGAGCAGCGGG + Intergenic
939683458 2:145168287-145168309 GCTGAAGCATCGGCCGCAGCTGG + Intergenic
940891089 2:159036109-159036131 GCTGAAGGACATGCAGCAGCTGG + Intronic
940912825 2:159224198-159224220 GCAGAAGCCTAAGCAGCAGCTGG - Intronic
942098560 2:172556215-172556237 GCTGAAGCTGCGGCTGAAGCCGG - Exonic
944447353 2:199805022-199805044 TCAGAAGCCCCAGCATCAGCTGG - Intronic
945225826 2:207530329-207530351 GCTGCCGCCCCGGCCGCCGCTGG - Intronic
946402949 2:219478016-219478038 GCTGGAGCCTGGCCAGCAGCCGG - Exonic
947162130 2:227225496-227225518 ACAGAAGACCCTGCAGCAGCAGG + Intronic
947578778 2:231298230-231298252 GATGAACCCCGGGCAGCAGATGG + Intronic
947774466 2:232697092-232697114 GCTGACCCCTTGGCAGCAGCCGG - Intergenic
947819859 2:233062067-233062089 TCTAAGGCCCCGGCAGCAGCAGG - Intronic
948309785 2:236976587-236976609 CCTGAAGGCCCGGCTGCTGCAGG + Intergenic
948449622 2:238061026-238061048 GCTGGATGCCCGGCAGCAGTGGG + Exonic
948751246 2:240134630-240134652 GCTGGGGCCAGGGCAGCAGCAGG - Intronic
1170573636 20:17647002-17647024 GCCTGAGCCCTGGCAGCAGCTGG + Intronic
1171370472 20:24659002-24659024 GTTGGAGACCGGGCAGCAGCTGG - Intronic
1171411102 20:24949531-24949553 GCTCAAGACCAGGCAGCAGAAGG - Exonic
1171428719 20:25065211-25065233 GCAGAGGCACCGGCAGCAGCAGG + Intergenic
1171449482 20:25225740-25225762 GCTGATGCCAGGGCAGCACCAGG - Exonic
1171465234 20:25323286-25323308 TCTGCAGCCCCTCCAGCAGCAGG - Intronic
1171532491 20:25861773-25861795 GCTGCAGCCGCGGCGGCGGCTGG + Intronic
1171532823 20:25863430-25863452 GCTGCAGCCGCGGCGGCGGCTGG + Intronic
1171544028 20:25987195-25987217 GCTGCAGCCTCCGCGGCAGCTGG - Intergenic
1171807101 20:29689678-29689700 CCTGCAGCCCTGGCGGCAGCTGG - Intergenic
1172264444 20:33598840-33598862 GCTGAAGCCATGGCAGAAGAAGG - Intronic
1173812941 20:45967610-45967632 GCAGCAGCCGCAGCAGCAGCTGG - Exonic
1174565875 20:51464110-51464132 TCTGAAACCCAGGCAGCAGTAGG - Intronic
1175601074 20:60273583-60273605 CCTGAAGCCCAGCCAGCAGTGGG - Intergenic
1176667120 21:9697967-9697989 GCTGAACCCCAGGCAGAAGCCGG - Intergenic
1178486902 21:33025232-33025254 GCTGCAGCTCCGACGGCAGCCGG - Intergenic
1178862148 21:36298398-36298420 GCTGTGGCCCTGGCAGGAGCTGG - Intergenic
1179967476 21:44815738-44815760 GCTGCAGCCCCGGGAGAGGCTGG + Intronic
1180172513 21:46067131-46067153 GCTGGGGCCACGGCCGCAGCTGG + Intergenic
1180875122 22:19171598-19171620 GCTCCAGCCCCAGCAGCAACGGG + Intergenic
1180947461 22:19704545-19704567 GCTGAAACTCCGGCGGCAGGAGG + Intergenic
1181030600 22:20147419-20147441 GCTGGACCCCCTGCAGCAGGTGG - Exonic
1181512710 22:23395962-23395984 GCTGGACCCCCTGCAGCAGGTGG + Intergenic
1181514406 22:23402780-23402802 GCTGCAGGCCAGGCAGCAGGAGG + Intergenic
1182150374 22:28023221-28023243 GCAGGAGCCACGGCAGCAGTTGG + Intronic
1182521272 22:30885800-30885822 GCTGCCTCCCCAGCAGCAGCTGG - Intronic
1183256486 22:36765678-36765700 GGTGAGGCCTGGGCAGCAGCAGG + Intronic
1183425554 22:37737324-37737346 GCTGGAGCCCCAGCAGGACCTGG - Intronic
950181658 3:10917861-10917883 CCTGAAGCTCCGGCAGCCTCCGG - Intronic
950418411 3:12882459-12882481 GCGGAACCCGCGGCGGCAGCCGG - Intergenic
951520071 3:23603142-23603164 GCTGAAGGCCAGACAGCACCAGG - Intergenic
952214958 3:31269047-31269069 GGTAAAGCACCGGAAGCAGCTGG + Intergenic
952857266 3:37782603-37782625 ACTGAAGCTCTGGGAGCAGCTGG - Intronic
952946051 3:38478410-38478432 CCTGAAGCCACTGCAGCTGCTGG + Exonic
954682357 3:52352635-52352657 GCTGAAGGACTGCCAGCAGCTGG + Exonic
955162582 3:56479111-56479133 GCTGAAGCACCTGCAGCACTGGG + Intergenic
955332531 3:58059562-58059584 TCTCCAGCCACGGCAGCAGCTGG + Intronic
955911616 3:63864068-63864090 GCGGGAGCCCGGGCTGCAGCCGG - Intergenic
960949950 3:122992879-122992901 GCCAAAGCCCAGGCAGCAGCTGG + Intronic
961360557 3:126364698-126364720 GCAGAGGCCCTGGCATCAGCTGG - Intergenic
961835142 3:129651732-129651754 GCTGCAGCAGCAGCAGCAGCAGG - Exonic
962222248 3:133573800-133573822 GCGGCAGCCCCGGCAGCCTCGGG + Exonic
962247293 3:133806153-133806175 CCTGAAGCAGCGGCAGCAGCTGG + Intronic
963091454 3:141487099-141487121 GAAGAAGCCGCCGCAGCAGCAGG - Exonic
964227904 3:154428756-154428778 GCTTCAGCCCCAGCGGCAGCGGG + Exonic
966516785 3:180828812-180828834 CCTGGAGGCCCGGCGGCAGCAGG - Intronic
966904517 3:184512632-184512654 GCTGGAGCTCTGGAAGCAGCTGG - Intronic
968083650 3:195864053-195864075 GCTCCATCCCCGGGAGCAGCAGG + Exonic
968591957 4:1463897-1463919 GCAGAAGGCCTGGCAGCAGGAGG - Intergenic
970399395 4:15703180-15703202 GCAGAAGCTGCAGCAGCAGCTGG - Exonic
970894250 4:21084068-21084090 GCTGGAGCCACAGCAGAAGCAGG - Intronic
971052436 4:22876331-22876353 GCAGAAGCACCCACAGCAGCTGG - Intergenic
974069323 4:57110044-57110066 GGTAAAGCCGGGGCAGCAGCCGG - Exonic
975706111 4:77113316-77113338 GCCGAAGCCACGGCAGGAGCGGG - Intergenic
977188524 4:93970991-93971013 GCTTCAGCCCCATCAGCAGCAGG + Intergenic
979824339 4:125215018-125215040 GGTGAAGCACAGACAGCAGCTGG + Intergenic
983168880 4:164513230-164513252 GCTGAGGCCCAGGGAGCAGGAGG + Intergenic
983390600 4:167125680-167125702 ACTCCAGCCCCGGCAGCAGAGGG + Intronic
983728714 4:170965982-170966004 GCTGAAGCTCTGGCAAGAGCAGG - Intergenic
985628416 5:1002182-1002204 GCTGCAGCTCAGGCAGAAGCAGG + Intergenic
985651170 5:1108455-1108477 CCGGGAGCCCCTGCAGCAGCTGG - Intronic
985748269 5:1660044-1660066 GCTGAAGCCCTCGCCCCAGCAGG - Intergenic
985969026 5:3360779-3360801 GCTGAAGTCCAGGCATCAGCAGG - Intergenic
988509854 5:31855539-31855561 GTTGAAGCCCCGGTAGGGGCGGG + Intronic
989163062 5:38410003-38410025 GCTGAAGGTCAGGCAGCAGGGGG - Intronic
991585449 5:68197033-68197055 TCAGAAGCCCAGTCAGCAGCAGG + Intronic
994047850 5:95329485-95329507 GCAGAAGCTCAGACAGCAGCAGG - Intergenic
995492517 5:112707788-112707810 CCTGGAGCACCGGCGGCAGCAGG + Intronic
995752960 5:115472793-115472815 GCCGAAGCCAAGGGAGCAGCTGG + Intergenic
997977087 5:138446813-138446835 ACTGAAGCCGTGGCAGAAGCTGG - Exonic
998295565 5:140966494-140966516 GCTGTAGCGGCAGCAGCAGCAGG + Exonic
998337106 5:141383058-141383080 GCTGGAGCCCCGGGAGCTGGCGG + Exonic
998987961 5:147782820-147782842 GCTGCTGGCCCGGCAGCTGCTGG + Intronic
999308461 5:150535848-150535870 GATGAAGCCACGGCGGTAGCGGG - Exonic
999649662 5:153753112-153753134 GCTGAAGCCAAGGCATTAGCTGG - Intronic
1001120307 5:168974824-168974846 CCTGAACCCCCTGCAGCAGTTGG - Intronic
1001476723 5:172055710-172055732 GCTGAAGGTGCGGCAGCAACAGG - Exonic
1002280031 5:178124498-178124520 GCTGAGGCCCCGCCAGCTGGAGG - Exonic
1002546957 5:179955156-179955178 GCTGCAGCACCCCCAGCAGCAGG - Exonic
1002702807 5:181137945-181137967 GCTTAAGCCCAGCCAGCATCTGG - Intergenic
1002912137 6:1498516-1498538 GTTGAAGGCCCTGCAGCAGTGGG - Intergenic
1002988652 6:2217022-2217044 GCTGAAGCCAGGGCGGCTGCGGG - Intronic
1003791645 6:9553095-9553117 GGTGAGGCTCCTGCAGCAGCAGG - Intergenic
1004364287 6:14998968-14998990 GCTGAAGCCACGGTGTCAGCTGG + Intergenic
1006055037 6:31377854-31377876 GGTGGAGCCCCAGCAGCTGCAGG + Intergenic
1006614966 6:35319951-35319973 GCAGCAGGCCCAGCAGCAGCTGG + Exonic
1006994639 6:38247434-38247456 GCTGAAGACCAGGCAGCAGATGG + Intronic
1007074668 6:39058897-39058919 GCTGGAGCCCAAGCAGCAACTGG + Intronic
1007247837 6:40475160-40475182 GCTGGTGCCCAGGCTGCAGCTGG - Intronic
1008592581 6:53009126-53009148 GCTAAAGCCCTGGCTGCAGCAGG - Intronic
1009971309 6:70628053-70628075 GGAGAGGCCCCGGCAGGAGCCGG - Intergenic
1011515078 6:88144923-88144945 CCTGAACCCCAGCCAGCAGCTGG - Exonic
1011540262 6:88420660-88420682 CCTGAACTCCCGGCAGTAGCCGG - Intergenic
1013290819 6:108717412-108717434 GCTGAGGCCGGGGCAGCTGCTGG + Intergenic
1017163934 6:151390824-151390846 GCAGCAGCGGCGGCAGCAGCAGG + Intronic
1017652459 6:156595958-156595980 GAAGGAACCCCGGCAGCAGCAGG + Intergenic
1017815218 6:158011295-158011317 GCTGAAATCCAGGCATCAGCAGG - Intronic
1017905876 6:158757231-158757253 GCTGGTGACCCGGCAGCTGCAGG + Exonic
1019278195 7:187042-187064 GCTGAGGCCCCATCAGCAACAGG - Intergenic
1019381545 7:726816-726838 CCTCCAGCCCCGGCAGCAGGCGG - Exonic
1019449978 7:1092475-1092497 GCTGCGGCCCCGGCGGCAGAAGG + Exonic
1019927769 7:4204689-4204711 GCCGCAGCCCCGGCGGCAGGCGG + Intronic
1020781249 7:12519049-12519071 GCTGAAGCCACTACTGCAGCAGG - Intergenic
1021838862 7:24706304-24706326 GCTGAAGCCCCGGCAGCAGCAGG - Exonic
1022971616 7:35522878-35522900 GCTGGAGCCACAGGAGCAGCAGG + Intergenic
1023858420 7:44201005-44201027 GCGGTGGCCCCGTCAGCAGCCGG + Intronic
1024901556 7:54323806-54323828 ACTCAAGCCTCGGCAACAGCAGG + Intergenic
1024993434 7:55253980-55254002 GCTGAAGGCCCGGGAGCACCTGG - Intronic
1025254514 7:57374545-57374567 GTTGATGCCCAGACAGCAGCAGG + Intergenic
1028588967 7:92477097-92477119 CCTGAACTCCCGGCAGTAGCCGG - Intronic
1029258892 7:99287924-99287946 GCTGAAGCTGCGGCGGGAGCTGG + Intergenic
1030810934 7:113971285-113971307 GCTGAAGGCCCGGTAGCCCCTGG + Intronic
1034327274 7:150248083-150248105 GCTGAAACCCTGGCAGGGGCAGG - Intronic
1034347847 7:150397995-150398017 GCTGAAGCCGCGGCCGCAGGCGG - Exonic
1034765935 7:153721374-153721396 GCTGAAACCCTGGCAGGGGCAGG + Intergenic
1034902185 7:154914576-154914598 GCTGCAGCCCTGGAAGCTGCTGG - Intergenic
1035372292 7:158387175-158387197 CCTGAAGCCAGGGCAGCCGCTGG - Intronic
1035693951 8:1579924-1579946 GCTGCAGCACAGGCAGCCGCAGG + Intronic
1036604856 8:10295743-10295765 TCTGCAGCCCAGGCAGCAGTGGG + Intronic
1037581806 8:20249811-20249833 GGAGAAGGCCCTGCAGCAGCTGG - Exonic
1037762829 8:21753113-21753135 GCTGAAGCCCCCGAATGAGCTGG - Intronic
1038011529 8:23480291-23480313 GCTGATGCCCCTGCAGCACAAGG + Intergenic
1038580810 8:28747841-28747863 GCTTAAGCCTCCACAGCAGCTGG + Intronic
1038613034 8:29071475-29071497 GCTGAAGCTGCGGGAGCGGCTGG - Intronic
1040598963 8:48865651-48865673 GCTGAAGCTCCTGGAGCTGCAGG + Intergenic
1042316800 8:67434709-67434731 GCTGCAGCAGTGGCAGCAGCAGG + Intronic
1045565486 8:103310382-103310404 GCCTCAGCCCCGGAAGCAGCTGG + Intronic
1046013357 8:108576703-108576725 GCTGAAGCCCTGGCAGCTCCAGG - Intergenic
1048876243 8:138838818-138838840 GCTGAAGCCAGGGAAGCCGCTGG + Intronic
1049599747 8:143501917-143501939 GCTGAAGCCCTGACCCCAGCGGG + Intronic
1049687008 8:143943056-143943078 GCTGAGTCCCCGGCAGCTCCGGG + Intronic
1051033822 9:12718552-12718574 ACTGAGGTCCCAGCAGCAGCAGG - Intergenic
1052192668 9:25677667-25677689 GCTGTAGCCGAGGCCGCAGCCGG - Exonic
1052973096 9:34390732-34390754 GCTTCAGCCTCCGCAGCAGCTGG + Intronic
1054160642 9:61670326-61670348 GCTGCAGCCACGGTGGCAGCTGG + Intergenic
1054914213 9:70480831-70480853 GCTGCCGCGGCGGCAGCAGCAGG - Intergenic
1055992860 9:82126444-82126466 GCAGAAGCAGCTGCAGCAGCAGG - Intergenic
1057219337 9:93247647-93247669 GCTGCAGCCCAAGGAGCAGCAGG + Exonic
1057466413 9:95317880-95317902 GCGGAAGCCCCGGCGGGAGCAGG + Intergenic
1058764542 9:108168622-108168644 TCTGTAGCCCTGGCAGCAGCAGG - Intergenic
1058830286 9:108810394-108810416 GCAGAAAACCCAGCAGCAGCTGG + Intergenic
1058866634 9:109167111-109167133 GCGGCCGCCCCGGCAGCACCCGG - Exonic
1060531587 9:124350106-124350128 GCCGAAGCAGCAGCAGCAGCAGG - Intronic
1060582282 9:124760195-124760217 GCTTCAGCCCCTGGAGCAGCTGG - Intronic
1060714849 9:125915808-125915830 GCTGCAGCCGCGGCAGCCTCTGG + Exonic
1061105075 9:128523714-128523736 GCTGCAGCTCAGCCAGCAGCTGG + Exonic
1061450799 9:130666053-130666075 AAAGAAGCACCGGCAGCAGCTGG - Intronic
1062334034 9:136057076-136057098 GCTCCATCCTCGGCAGCAGCAGG + Intronic
1062624185 9:137435537-137435559 GCTGTGGCCACGGCCGCAGCTGG - Intronic
1203658976 Un_KI270753v1:23795-23817 GCTGAACCCCAGGCAGAAGCCGG + Intergenic
1203669421 Un_KI270754v1:37880-37902 GCTGCCGCCCCGGCAGCGCCTGG + Intergenic
1185495684 X:553287-553309 TCTGAACCCCTGGCAGCTGCTGG + Intergenic
1185643439 X:1600697-1600719 GCTGAGGCTCCAGCAGCAGGAGG + Exonic
1186152246 X:6687757-6687779 GCGGATGCCACGGCAACAGCAGG - Intergenic
1187443775 X:19343599-19343621 GCTGCAGCACCGGCAGGAGTAGG + Intergenic
1190339544 X:49286031-49286053 CCTGGAGCCCAGTCAGCAGCAGG + Exonic
1192317261 X:70062692-70062714 TCAGAAGCACCGGCAGGAGCTGG + Exonic
1194665000 X:96667704-96667726 TCTGAAGTCCAGGCATCAGCAGG + Intergenic
1199635458 X:149808168-149808190 GCTGGAGTGCGGGCAGCAGCTGG - Intergenic
1200061640 X:153486376-153486398 GCTGGAGCCCTGCCAGCATCCGG - Intronic
1200072535 X:153536283-153536305 CCCCAAGCCCCAGCAGCAGCGGG + Exonic
1200076137 X:153552098-153552120 GCTGAGGCCCCCACACCAGCAGG - Intronic
1200209699 X:154341760-154341782 GCCGACGCCCCGGCAGCGGCGGG + Intergenic
1200221153 X:154390332-154390354 GCCGACGCCCCGGCAGCGGCGGG - Intronic
1201073189 Y:10168769-10168791 GCTGCAGCCCCACCAGGAGCCGG + Intergenic
1201690788 Y:16762500-16762522 ACTGAAGCCACAGCAACAGCAGG - Intergenic