ID: 1021839691

View in Genome Browser
Species Human (GRCh38)
Location 7:24712636-24712658
Sequence CAGAGTGACCAGCGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021839678_1021839691 30 Left 1021839678 7:24712583-24712605 CCTTGACGATGAGTGTGGTAAGA 0: 1
1: 0
2: 1
3: 6
4: 56
Right 1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG 0: 1
1: 0
2: 2
3: 24
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021839691 Original CRISPR CAGAGTGACCAGCGGGTGGA GGG Intronic
901067549 1:6501534-6501556 CAGAGTTCCCAGCAGGTGGTTGG - Intronic
901653834 1:10757938-10757960 CAGAGTGGCCAGGACGTGGATGG - Intronic
903015630 1:20359924-20359946 CAGAGTTACCAGTGGGGCGAGGG - Intergenic
903323631 1:22556828-22556850 CAGTGTGGCTAGCGGCTGGAAGG + Intergenic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
909931405 1:81503446-81503468 CAGAGGGACCAGCTGGTGGAGGG - Intronic
910624214 1:89289309-89289331 CACAGTGACAAGGGGGTGGCTGG - Intergenic
911180136 1:94853161-94853183 GGGAGTGACCAGTGGGTCGAAGG + Intronic
914918446 1:151832117-151832139 CAGATTGATCAGTGAGTGGAGGG + Intergenic
915082724 1:153363063-153363085 CTGATTGAACAGGGGGTGGAGGG - Intergenic
915805782 1:158848006-158848028 CAGAGAGTCCAGCGAGTGGAAGG + Intronic
917968588 1:180193680-180193702 CAGAGGGTCCAGTGGGTGGGAGG + Intronic
1068734390 10:60395741-60395763 CACAGTGACCAGCAGGGTGAGGG - Intronic
1069548245 10:69344123-69344145 CAGATGGATCAGCGGATGGATGG - Intronic
1070400714 10:76051127-76051149 CAGAGCGACCAGACGGCGGAGGG - Intronic
1070425866 10:76286505-76286527 CTGAGTGACCAGAGAGGGGATGG + Intronic
1071602072 10:86963171-86963193 CAGAAGGACCAGAGGGTGGGTGG - Exonic
1072306568 10:94113478-94113500 CTGAGTGTTCAGAGGGTGGATGG + Intronic
1076480573 10:130782662-130782684 CAGAGAGACCAGCAGGGGGAGGG + Intergenic
1076988029 11:253405-253427 CAGAGTGAACATTAGGTGGAAGG + Intergenic
1077065152 11:637766-637788 CAGACAGCGCAGCGGGTGGAAGG - Intronic
1079281739 11:19093496-19093518 CAAAGAGAACAGGGGGTGGAGGG - Intergenic
1083665751 11:64273578-64273600 CAGAGTGAGAAGCAGGTGGGGGG + Intronic
1084630616 11:70346185-70346207 CAGTGTGACCAGGGGGTGCCTGG + Intronic
1084915222 11:72423900-72423922 TAGAGGGAACAGCAGGTGGAAGG - Intronic
1085960687 11:81458039-81458061 CAGAGGGACTAGCAGGTGAAAGG - Intergenic
1089248252 11:117137978-117138000 CAGGGTGACCTGCGGGGTGAAGG + Intergenic
1089258459 11:117206583-117206605 CAGGGTGACCTGCGGGGTGAAGG - Intronic
1090531925 11:127600091-127600113 CAGTGTGACCAGCTTGTTGAAGG + Intergenic
1096159960 12:49367733-49367755 CGAAGTGCCCAGAGGGTGGAAGG + Intronic
1098429567 12:70405005-70405027 AAGAGTGGCCAGAGGGTGAAAGG + Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1104057280 12:125240113-125240135 CAGAATCACCAGAAGGTGGAAGG - Intronic
1105614790 13:22001796-22001818 CACAGTGACCAGACGGTGCATGG - Intergenic
1106696130 13:32175397-32175419 GTGAGTGCCCAGAGGGTGGAAGG - Intronic
1111580076 13:90211327-90211349 CAGAGTGTCCATCAGGTGGCAGG - Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1113902439 13:113804500-113804522 CAGTGTGACTAGCAGGTGGCGGG + Intronic
1113905144 13:113815821-113815843 CCGGGTGACCCGCGTGTGGATGG - Exonic
1115100081 14:29688176-29688198 CAGAGGGACCATAGGGTGAAAGG - Intronic
1115444961 14:33479447-33479469 CAGAGTGACAAGTGGGTGAAGGG - Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1121198026 14:92092136-92092158 CAGATTGACCAGCGGTTGCCTGG - Intronic
1121527399 14:94628560-94628582 GCTAGTGACCAGCAGGTGGATGG - Intergenic
1122079218 14:99255436-99255458 CAGGGGGGCCAGGGGGTGGAAGG + Intronic
1123028561 14:105439912-105439934 CAGAGGGGGCAGCGGGGGGAAGG + Intronic
1126860698 15:52879958-52879980 AAGAGGGACCAGCAGGAGGATGG - Intergenic
1127453673 15:59139458-59139480 CAGAGTAATGAGCGGGTGAAAGG - Intronic
1128151754 15:65367621-65367643 GAGAGTGGCCAGCGGGTGGCGGG - Intronic
1129181951 15:73883209-73883231 CAGAGTGACCCGGGGTGGGACGG + Intronic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129295069 15:74595751-74595773 CAGAGGGACCAGCTGGTGGAGGG - Exonic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132336964 15:101053875-101053897 CAGAGTGGCCAGAGGGTGAAAGG + Intronic
1132348514 15:101122804-101122826 CCCAGTGAGCCGCGGGTGGACGG - Intergenic
1132734435 16:1378558-1378580 CAGAGTGCGCAGCATGTGGAGGG + Intronic
1132861961 16:2076247-2076269 CAGAGTGACAGGCAGGTGGAGGG + Intronic
1133740380 16:8646830-8646852 CAGAGAGACCAAGGGGCGGAGGG - Exonic
1133889008 16:9860666-9860688 CAGAGTGACAAGCTGGGAGATGG + Intronic
1134271969 16:12740753-12740775 CAGAGTGAACAGCAGGTGCAAGG + Intronic
1136088617 16:27903015-27903037 CCGAGTGACCAGAGGCTGCAGGG + Intronic
1137569619 16:49557143-49557165 GAGAGTGACCAGGGCGTGCAGGG + Intronic
1141191178 16:81825777-81825799 CAGAGTCTCCAGCATGTGGAGGG - Intronic
1142280963 16:89147315-89147337 CAGAGTGAGCAAGGGGGGGAGGG + Intronic
1142869317 17:2809921-2809943 CAGAGGAGCCAGCGGGAGGAAGG - Intronic
1143166247 17:4898628-4898650 CAGATTGATCAGCAGGGGGAAGG + Exonic
1143373973 17:6456681-6456703 GAGAGTGACCCGCGGGTAGAGGG - Intronic
1146927356 17:36754236-36754258 CAGAGAGACCAGTGGAAGGAGGG + Intergenic
1147608774 17:41789126-41789148 CAGGGTGACAAGCAGGTGGATGG - Intergenic
1148221690 17:45867114-45867136 TAGAGTGACCAGTGGCTGAAGGG - Intergenic
1151824403 17:76515792-76515814 CACAGTGACTCTCGGGTGGAGGG + Intergenic
1152034077 17:77861286-77861308 CAGATTGATGAGTGGGTGGATGG + Intergenic
1152092008 17:78252354-78252376 CAGAGTGTGCAGCTGGTGGATGG - Intergenic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1152892682 17:82891393-82891415 CACAGTGACCAGCATGCGGACGG + Intronic
1153806461 18:8712435-8712457 CAGTGTGGCCTGGGGGTGGAGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157045608 18:44099235-44099257 CAGAGTGATCAGCTGGTGTGGGG + Intergenic
1157785044 18:50474178-50474200 CAAAATGACCAGTGGGTGGATGG + Intergenic
1158954322 18:62524242-62524264 CAGGGTGACCCGCTGGTGGAAGG - Exonic
1159456782 18:68669366-68669388 CAGGGGGACCAGCGAGTGCAAGG + Intergenic
1159685471 18:71413685-71413707 CAGAGTGAGCAGCCCCTGGATGG - Intergenic
1159935492 18:74363571-74363593 CATGGTGTCCTGCGGGTGGAGGG - Intergenic
1159954946 18:74512675-74512697 CAGAGGGACAAGTGAGTGGAAGG - Intronic
1160542101 18:79629413-79629435 CAGACTGACCATCGAGTGCAGGG + Intergenic
1160677445 19:398968-398990 CAAAGTGACCCCCGGGTGGCCGG - Intergenic
1160775219 19:852410-852432 CAGAGGGAGCAGCGGGAGGTTGG - Intronic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161684962 19:5698074-5698096 CAGATTGACTAGGGGGTGGGGGG - Intronic
1161903258 19:7135680-7135702 CACCGTGCCCAGCTGGTGGAAGG - Intronic
1161998601 19:7729839-7729861 CAGGGCTACCAGTGGGTGGACGG - Exonic
1162916011 19:13874802-13874824 CAGAGTCACCGGCAGGAGGATGG - Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163510885 19:17734259-17734281 CAGGGTCACCTGCAGGTGGAGGG - Exonic
1165060271 19:33201724-33201746 CAGATGGACCAGCGTGGGGAAGG + Intronic
1166162066 19:40961556-40961578 TAGAATGACTAACGGGTGGATGG - Intergenic
1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG + Intronic
925145911 2:1583272-1583294 AAGAGTGACCAGCGGGAGGGAGG - Intergenic
925154156 2:1637388-1637410 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154165 2:1637462-1637484 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154201 2:1637684-1637706 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154217 2:1637759-1637781 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925319538 2:2951627-2951649 CAGAATAACCAATGGGTGGATGG - Intergenic
929986649 2:46740628-46740650 CAGAGATACCAGCTGGTGGCTGG + Intronic
933335401 2:80951642-80951664 AAGAGTGACCATCTGATGGAGGG - Intergenic
934660872 2:96143058-96143080 CAGAGGGGCCAGCGGCCGGAAGG - Intergenic
935321492 2:101893838-101893860 CAGAGTGCCCACCGGGTGCCTGG - Intronic
935821291 2:106895502-106895524 CTGAGTGACCAGGGGGTGGGTGG - Intergenic
936147160 2:109987605-109987627 CAGAGAGGCCAGTGGGTGCATGG + Intergenic
936197532 2:110383878-110383900 CAGAGAGGCCAGTGGGTGCATGG - Intergenic
938294813 2:130171620-130171642 CAGATTCCCCAGAGGGTGGAGGG - Intronic
938461818 2:131502224-131502246 CAGATTCCCCAGAGGGTGGAGGG + Intergenic
939086715 2:137728261-137728283 CAGAGAGAGTAGTGGGTGGAGGG - Intergenic
940014697 2:149091994-149092016 CAGATTGGGCTGCGGGTGGAAGG + Intronic
945180385 2:207085487-207085509 CTGAGTGACCAGTGGCTAGAGGG - Intronic
947860296 2:233353627-233353649 GGGAGTGACCAGCGACTGGAGGG - Intergenic
948285754 2:236783799-236783821 CAGAGTGAACAGCGGGAGATGGG - Intergenic
948586135 2:239020896-239020918 GACAGTGACCAGCGGGTGTTGGG + Intergenic
1172669480 20:36625047-36625069 CAGAGTGTCCAGCATGTGGTGGG - Intronic
1172881486 20:38202704-38202726 CAGCCTGACCTGGGGGTGGAGGG + Intergenic
1173914366 20:46695911-46695933 CCCAGTGACTAGTGGGTGGAAGG - Intergenic
1174157935 20:48528683-48528705 GAAAGAGACCAGCAGGTGGAAGG + Intergenic
1174203950 20:48826341-48826363 AAAAGTGGCCAGCGGGTGGAGGG - Intronic
1174399289 20:50267372-50267394 CAGAGTGCCCAGCATGTGGTAGG - Intergenic
1177514554 21:22131896-22131918 GAAAGTGAGCAGCCGGTGGAAGG + Intergenic
1178929229 21:36803087-36803109 CATGGTGACAACCGGGTGGATGG + Intronic
1180014123 21:45071919-45071941 CACAGTGAACAGGGGATGGATGG + Intergenic
1181342697 22:22195565-22195587 CAGAAACACCAGCAGGTGGAGGG - Intergenic
1181450636 22:23017536-23017558 CAGAGCGACCAAGGGGTGGGAGG + Intergenic
1183457560 22:37930888-37930910 CAGAGTCCCCAGCGGGGAGAGGG + Intronic
1183654939 22:39179231-39179253 CACAGTGCCTAGCGTGTGGATGG - Intergenic
1184245135 22:43231923-43231945 TTGTGTGACCAGCGGGGGGACGG + Intronic
1184406684 22:44304536-44304558 CAGAGAGGCCTGCGGGTGGATGG - Intronic
1185109519 22:48893328-48893350 CAGAGAGACCTGGGTGTGGACGG + Intergenic
950442214 3:13016626-13016648 CAGAGAGAGCAGCTGGTGTAAGG - Intronic
950607642 3:14096874-14096896 CAGCCTGAGCAGCAGGTGGATGG + Intergenic
952673676 3:36000796-36000818 CAGAGTGCCCAGGGGAAGGAGGG - Intergenic
952773522 3:37022977-37022999 CAGTGTGACCTGCTGGTGGCAGG - Intronic
953320267 3:41964897-41964919 GAGAGTCAGCAGCGGGTGGTGGG - Intergenic
953781476 3:45874865-45874887 CAGACTAGCCAGCTGGTGGATGG + Intronic
954330128 3:49885412-49885434 CAGAGCGAGCAGCAGCTGGATGG + Intergenic
956749598 3:72335534-72335556 CAGAGCCACCTGCGGGTTGAGGG + Intergenic
958759542 3:98291462-98291484 CAGAGTGATCAGGGGCTGAAGGG - Intergenic
961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG + Intronic
961797849 3:129422575-129422597 AAGAGTGCCCAGGGTGTGGATGG - Intronic
964949084 3:162265101-162265123 CTCAGTGAGCAGGGGGTGGAAGG - Intergenic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG + Intergenic
968295939 3:197576792-197576814 CAGAGACCCCAGGGGGTGGAGGG - Intergenic
969002889 4:3996395-3996417 CAGACTGATCAGCTGGTGGTGGG + Intergenic
969182413 4:5452264-5452286 CAGAGAGGCCAGCGAGTGGAGGG + Intronic
969719183 4:8883639-8883661 CAGAGCCACCAGGGGCTGGAAGG - Intergenic
969811049 4:9648424-9648446 CAGACTGATCAGCTGGTGGTGGG - Intergenic
970046634 4:11861793-11861815 CAGAGAGATCAGCTGCTGGATGG + Intergenic
970579741 4:17464408-17464430 CTGAGTGACTAGTGGGTGGGTGG - Intronic
972562828 4:40243735-40243757 CAGACTGACCAGCGGGAGATGGG + Exonic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975940504 4:79638921-79638943 CAGAGGGAGCAGCAGGTGCAAGG - Intergenic
983639670 4:169933409-169933431 TAGAGTGACCTGGGGGAGGATGG + Intergenic
984526631 4:180866243-180866265 CAGAGTGGCAAGGGGGTGGCGGG + Intergenic
984583281 4:181534741-181534763 AACAGTGAACGGCGGGTGGAGGG - Intergenic
985548573 5:522005-522027 CAGAGTGCACAGTGGGTTGAGGG + Intronic
988978131 5:36535965-36535987 CACACTGACCAGCGGATGGAGGG - Intergenic
990159780 5:52924623-52924645 CAGAGTGAAGAGTGGTTGGAGGG + Intronic
993917076 5:93756339-93756361 CAGAGGGACCAGCGGTGGGCAGG - Intronic
994525638 5:100902110-100902132 CACAGAGGCCAGCGGGTGGAAGG + Intronic
995320032 5:110824034-110824056 GAGAGTGACTAGGGGGTGGGTGG - Intergenic
997061619 5:130511585-130511607 CAGAGTGAACAGTCAGTGGAAGG + Intergenic
999326911 5:150649497-150649519 CAGAGGGACCAGGGGGAGGTAGG + Exonic
999595726 5:153202064-153202086 AAGAGTGATAAGGGGGTGGATGG - Intergenic
1002493936 5:179599268-179599290 CAGAGTGGGCAGCTGGTGGAGGG + Intronic
1002956857 6:1874014-1874036 CAGACGGACCAGTGGGAGGAAGG + Intronic
1006055329 6:31379680-31379702 CATAGTTGCCAGAGGGTGGAAGG + Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1007116956 6:39349557-39349579 CAGGGGGAGCAGTGGGTGGAAGG + Intronic
1014758363 6:125327052-125327074 CAGAAGGACCAGAGGGGGGAAGG - Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1022776914 7:33536260-33536282 CAGAGTGGCAAGCGGGTCGTCGG - Intronic
1029200648 7:98837052-98837074 CAGAGTGACCAGGTGGAGGTTGG - Intergenic
1032012653 7:128356954-128356976 CAGAGTGGTCAGGGAGTGGAGGG + Intronic
1032437382 7:131911188-131911210 TGGAGTGAAGAGCGGGTGGAAGG - Intergenic
1033796710 7:144853906-144853928 CAGAGTGAGTAGTGTGTGGAAGG - Intergenic
1035113355 7:156503466-156503488 CAGAGTGACCGCTGCGTGGATGG - Intergenic
1036208392 8:6822101-6822123 CACAGAGACCAGGGGCTGGAAGG + Intronic
1036648433 8:10626225-10626247 CAGAGTGAATAGCGGGAGGATGG + Intronic
1037908180 8:22727715-22727737 CAGAGCAACCAGCGGGGGAAGGG + Intronic
1038313727 8:26465426-26465448 CAGAGGGACCAGGGGGTGGGAGG - Intronic
1041162991 8:55063646-55063668 CACAGAGAACAGCAGGTGGAGGG + Intergenic
1041746835 8:61216387-61216409 CAGACAGACTAGAGGGTGGATGG - Intronic
1042186683 8:66142760-66142782 CAAAGGGGCCAGCTGGTGGAGGG + Intronic
1043587206 8:81783294-81783316 CAGATTGATAAGAGGGTGGAAGG + Intergenic
1044725479 8:95191189-95191211 CAGGGTGACATGCAGGTGGATGG + Intergenic
1045820087 8:106326683-106326705 CAGAGGGACCAGCCAGTGCAAGG + Intronic
1045968745 8:108055992-108056014 CTGAGGGACCAGAGGGTGAATGG - Intronic
1047723141 8:127660819-127660841 CAGACAGACCAGTGGGTGAAGGG + Intergenic
1048604405 8:135952715-135952737 CAGACTGCCCTGTGGGTGGAAGG + Intergenic
1048924764 8:139261623-139261645 CAAAGAGACCAGAGGCTGGAAGG - Intergenic
1049148946 8:141022007-141022029 CAGGGTGACCACCGGCAGGACGG + Intergenic
1049610672 8:143553399-143553421 CAGAGTGAGCGGCGGGCGGCGGG - Exonic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1051374113 9:16386883-16386905 CAGAGAGACCAGCAGGAGGCAGG + Intergenic
1053320857 9:37097810-37097832 CAGAATCAGCAGAGGGTGGAGGG + Intergenic
1055269382 9:74540241-74540263 CAGAGTGAGCAGAGGGGGCAGGG - Intronic
1056071695 9:82993805-82993827 CAGTGGGTCCAGCTGGTGGAGGG - Intronic
1057577313 9:96253575-96253597 TGGAGTGACCAGAGAGTGGATGG - Intronic
1061730579 9:132610928-132610950 CAGAGGGACCACCCAGTGGAGGG - Intronic
1062113841 9:134797007-134797029 CACAGTGGCCGGTGGGTGGAGGG + Intronic
1062207407 9:135344811-135344833 CACAGTGACCACCAGGTGGCAGG + Intronic
1062342126 9:136098410-136098432 CAGTGGGAACAGCGGGTGCAAGG - Intergenic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1190391490 X:49935923-49935945 CAGAGTGACCAGTGAATGAATGG + Intronic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1201591926 Y:15625110-15625132 CAGAGGGAGCAGCGTGTGGCTGG + Intergenic