ID: 1021839811

View in Genome Browser
Species Human (GRCh38)
Location 7:24713458-24713480
Sequence CCTGAACCCCGTCACAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021839806_1021839811 9 Left 1021839806 7:24713426-24713448 CCTTCACTTTAAAATATCTTAGG 0: 1
1: 0
2: 0
3: 20
4: 284
Right 1021839811 7:24713458-24713480 CCTGAACCCCGTCACAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021839811 Original CRISPR CCTGAACCCCGTCACAGGGA AGG Intronic
No off target data available for this crispr