ID: 1021840995

View in Genome Browser
Species Human (GRCh38)
Location 7:24721800-24721822
Sequence GATCACATGGGGCCTCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021840995 Original CRISPR GATCACATGGGGCCTCAGCC TGG (reversed) Intronic
901870488 1:12135821-12135843 CCTCGCCTGGGGCCTCAGCCAGG + Intronic
902099016 1:13969718-13969740 TGTCACATGGAACCTCAGCCAGG - Intergenic
903052903 1:20614796-20614818 GATCACATGGGGCCTGGCCATGG + Intronic
903189164 1:21646923-21646945 GATCACATCTGGCCTCTACCAGG + Intronic
903195138 1:21680605-21680627 CCTCAAATGGGGCCTCAGCTGGG - Intronic
903529631 1:24020334-24020356 GTTGATCTGGGGCCTCAGCCAGG + Intergenic
903882423 1:26520553-26520575 GAAGACATGAGGCCTCAGCCTGG - Intergenic
906394230 1:45446920-45446942 TTTAAAATGGGGCCTCAGCCAGG + Intronic
907220984 1:52906730-52906752 CATTACATGGAACCTCAGCCAGG + Intronic
907371481 1:54006407-54006429 GTTCACATGCCCCCTCAGCCTGG + Intergenic
913349536 1:117842503-117842525 CCTCTCCTGGGGCCTCAGCCTGG + Intergenic
920107365 1:203563480-203563502 GATGACATGGGGCTCCACCCAGG - Intergenic
922706353 1:227792773-227792795 GAGCACGTGGTGCCCCAGCCTGG - Intergenic
923679912 1:236111002-236111024 GATCACTTGGTGCCTGACCCTGG + Intergenic
1064082952 10:12323243-12323265 CATCAGATGGGGCCACAGGCTGG + Intergenic
1065865209 10:29909105-29909127 GAGGAAATGGGGCCTCAGCGAGG - Intergenic
1067136951 10:43617967-43617989 GATCACATGGCACTCCAGCCTGG - Intergenic
1067787812 10:49263576-49263598 GATAAAAATGGGCCTCAGCCTGG + Intergenic
1069590209 10:69636809-69636831 GATCTCATGGGGCTGCAGGCAGG - Intergenic
1070455079 10:76605149-76605171 GAGGACATGTGGACTCAGCCAGG - Intergenic
1071285761 10:84143157-84143179 GCTCACATAGGGCCTCAGGAGGG + Intronic
1072783923 10:98267982-98268004 GATCCCTTGGACCCTCAGCCCGG - Intronic
1073425080 10:103451375-103451397 GAGGACATGGGGCCACACCCTGG - Intronic
1075152724 10:119948931-119948953 GATCACATGGCACTCCAGCCTGG + Intergenic
1075380458 10:122014575-122014597 TATAAAATGGGGCATCAGCCTGG + Intronic
1076300015 10:129418890-129418912 GATCCCCCGGGGCCACAGCCAGG - Intergenic
1077102548 11:828585-828607 GAGAGCAGGGGGCCTCAGCCTGG - Exonic
1080393246 11:31867156-31867178 GATTATCTGGGGCCTCAGCAGGG + Intronic
1080632753 11:34094275-34094297 GATCACCTGAGGCCTGAGGCAGG - Intronic
1081988880 11:47327008-47327030 GAGCAAATGGGGCCTCAGGTGGG + Intronic
1083147678 11:60771252-60771274 GACCAGGTGAGGCCTCAGCCAGG - Intronic
1083255325 11:61491850-61491872 GCCCACATGGAGCCCCAGCCGGG - Intergenic
1083623999 11:64062732-64062754 GGGCATCTGGGGCCTCAGCCTGG - Intronic
1083914481 11:65731642-65731664 GATCATATCAGGCCTGAGCCTGG + Intergenic
1084330344 11:68426265-68426287 GATCCTGTGTGGCCTCAGCCAGG + Intronic
1084375930 11:68777553-68777575 GATCACATAAGCCCCCAGCCAGG + Intronic
1084420110 11:69056233-69056255 GGTCGCGTGGGGCCTCTGCCCGG + Intronic
1085283376 11:75345066-75345088 GCTCAACTGTGGCCTCAGCCAGG + Intronic
1088218176 11:107537049-107537071 AATCACATAGGGTTTCAGCCTGG + Intronic
1091389294 12:116323-116345 GAGCACATGAGGCTGCAGCCAGG - Intronic
1091897993 12:4120185-4120207 GACCACATGGTGCCTCTGGCAGG + Intergenic
1098372987 12:69780082-69780104 GATGACATGGTGCTCCAGCCAGG + Intronic
1098704031 12:73664907-73664929 CCTCACTTGGGGCCCCAGCCTGG + Intergenic
1099661476 12:85568589-85568611 GTTCACATGGGCCCTGAGCAGGG + Intergenic
1100026172 12:90130682-90130704 GAGCACATGGGACCTAAGCGAGG + Intergenic
1100441540 12:94621828-94621850 AATCACTTGGGGCCTCTTCCTGG - Intronic
1102531710 12:113551529-113551551 GATAAGCTGGGGCCTCTGCCTGG - Intergenic
1102898894 12:116620809-116620831 GATCACACGGGGCCTCGCACAGG - Intergenic
1103413808 12:120731037-120731059 GATCACTTGAGCCCTGAGCCCGG - Intronic
1103874993 12:124120155-124120177 GTTCAGATGGGGCCCCACCCAGG - Intronic
1104029766 12:125056364-125056386 GACCTCATGGCACCTCAGCCAGG - Intergenic
1104499971 12:129275693-129275715 ACTCACATGGGACCTGAGCCCGG - Intronic
1107024497 13:35785648-35785670 GATCACATGAGGGCACAGGCTGG - Intronic
1109134823 13:58634303-58634325 GATCACCTGAGCCCTGAGCCCGG - Intergenic
1114653744 14:24303467-24303489 AATAACATTTGGCCTCAGCCGGG - Intronic
1115883410 14:37945616-37945638 CATCTCCTGGGGCCCCAGCCTGG + Intronic
1118124755 14:62889362-62889384 CATCACATGGGGGCCAAGCCAGG + Intronic
1124239327 15:28017036-28017058 GATCACCTGGGGAGGCAGCCTGG + Intronic
1125138979 15:36380765-36380787 GATGACGTGGGGCCTCAAACTGG + Intergenic
1127995452 15:64151269-64151291 GCTCAGGTGTGGCCTCAGCCGGG + Intergenic
1128732155 15:70028650-70028672 GATCACCTGGGGAATCACCCAGG - Intergenic
1128945228 15:71815157-71815179 GATGTCATGGAGCCTCAGCAAGG + Intronic
1130516347 15:84628891-84628913 GAACACATGGGGCCTCAGAGAGG + Intergenic
1133817181 16:9206847-9206869 TATCAGCTGGGACCTCAGCCAGG - Intergenic
1135640975 16:24119539-24119561 AATCAGATGGGTCCTGAGCCAGG + Intronic
1136608904 16:31354587-31354609 GACCACAGGGTGCCTCACCCGGG - Intergenic
1140142581 16:72272712-72272734 GAGCACATGAGGCTTTAGCCTGG + Intergenic
1142411917 16:89921303-89921325 GACCACATGTGACCTCAGCCGGG + Intronic
1142808925 17:2386310-2386332 GGACAGGTGGGGCCTCAGCCTGG - Exonic
1144575788 17:16428544-16428566 GAGCACAAGGGGCCCCAGGCTGG - Intronic
1144838487 17:18171163-18171185 GATGCCCAGGGGCCTCAGCCTGG + Intronic
1144889114 17:18483843-18483865 GAAGACATGGGGCCTCAGTCAGG - Intronic
1145143095 17:20460453-20460475 GAAGACATGGGGCCTCAGTCAGG + Intronic
1146778362 17:35643241-35643263 GGTCACATGTGGCCTCAGGTTGG + Intronic
1147234772 17:39049206-39049228 GATAACTTGAGGCCACAGCCTGG + Intergenic
1147466386 17:40614415-40614437 GATACCATGGTGCCTCAGGCTGG + Intergenic
1147611852 17:41806550-41806572 GCTCACATGGTGCCTCCTCCAGG - Intronic
1148126635 17:45240853-45240875 GTTCACCTGGGGTCTGAGCCTGG - Intronic
1151029230 17:70716558-70716580 GCTCACATAGTGCCTGAGCCCGG - Intergenic
1151555524 17:74844637-74844659 GACCACATGGGGATCCAGCCTGG + Intronic
1151802537 17:76386364-76386386 AAGCACACGTGGCCTCAGCCTGG - Intronic
1152486704 17:80599314-80599336 GGTCTCAGGGGGCCTCAGCTGGG - Intronic
1153418612 18:4879049-4879071 GATCAAATGGGGCCCCCTCCTGG - Intergenic
1156536050 18:37865623-37865645 TATCCCATGGGACCCCAGCCAGG + Intergenic
1160154265 18:76421482-76421504 GAACTCACGGGGGCTCAGCCCGG - Intronic
1160846751 19:1169391-1169413 GCTCTCACGGGGCCTCCGCCTGG + Intronic
1161962404 19:7529975-7529997 ATTCACATGGGACCCCAGCCTGG + Intronic
1162038958 19:7957897-7957919 GCTAACATGGGCCCGCAGCCCGG - Intergenic
1162970044 19:14175219-14175241 GCACACGTGGTGCCTCAGCCTGG + Intronic
1163125792 19:15243521-15243543 GAGCACCTGTGGCCCCAGCCTGG + Intronic
1163477578 19:17535536-17535558 GATCACCTGAGGTCCCAGCCTGG + Intronic
1163956981 19:20652151-20652173 GATAACATCTGGCCTCTGCCTGG - Intronic
1164136739 19:22423246-22423268 GATCACCTGGGAGTTCAGCCTGG - Intronic
1164180206 19:22811616-22811638 CATCACCTGGGTACTCAGCCAGG - Intergenic
1164206753 19:23065480-23065502 CATCACCTGGGTGCTCAGCCAGG + Intergenic
1164233233 19:23309503-23309525 CATCACCTGGGTTCTCAGCCAGG - Intronic
1164234023 19:23316501-23316523 CATCACCTGGGTACTCAGCCAGG - Intronic
1164303802 19:23985764-23985786 TATCACCTGGGTTCTCAGCCAGG + Intergenic
1164312011 19:24054206-24054228 TATCACCTGGGTGCTCAGCCAGG - Intronic
1164801022 19:31076819-31076841 GATCGCATGGGCCCTGGGCCCGG + Intergenic
1165283425 19:34816999-34817021 GAACACCAGGGGCCTAAGCCAGG + Intergenic
1165461285 19:35945580-35945602 GATCACATGTGTCCTCCTCCAGG - Exonic
1168159620 19:54501041-54501063 GGTCAGATGGGCACTCAGCCGGG - Intronic
929044349 2:37775584-37775606 GGTCCCATTGAGCCTCAGCCTGG - Intergenic
935405784 2:102707694-102707716 GATCCCAGGAGGGCTCAGCCTGG - Intronic
939774017 2:146361889-146361911 GATCTCATAGGGCCAGAGCCTGG - Intergenic
944899465 2:204199443-204199465 GATCACATGTGCCCTCAATCAGG + Intergenic
945771152 2:214044681-214044703 CATCCCATGTGGCCTCTGCCAGG - Intronic
946907641 2:224431632-224431654 GATCACCTGAGCCCTGAGCCAGG + Intergenic
947622599 2:231600368-231600390 GACCACATGGGGCCTTTGCAGGG - Intergenic
947920672 2:233868446-233868468 AATCAAATGGGGCTTCCGCCCGG - Intergenic
949014385 2:241701548-241701570 GAGCCCCCGGGGCCTCAGCCCGG - Intergenic
1169422251 20:5470114-5470136 TCTCACATGGGGCTTCTGCCTGG + Intergenic
1172619926 20:36312079-36312101 GTTCAGATGGGGCCTCTGGCGGG - Intronic
1173263476 20:41457410-41457432 GGTGACATCGGGCCTGAGCCTGG + Exonic
1174186637 20:48710940-48710962 GATCACATGAGGCCGCAGTGGGG + Intronic
1174565104 20:51458836-51458858 GATTACAAGAGGCCACAGCCAGG + Intronic
1176055013 20:63140787-63140809 GAGCCCATGGGACCACAGCCCGG + Intergenic
1179279695 21:39924097-39924119 GATCACTCGGGCCCTCATCCAGG - Intronic
1180970459 22:19812251-19812273 GAGAACATGGGGCCTCAGGCAGG + Intronic
1181957455 22:26598468-26598490 GATCACTTGAGGCTTTAGCCTGG - Intergenic
1182118753 22:27773486-27773508 GAGCACGTGAGGCCCCAGCCTGG - Intronic
1182972373 22:34590292-34590314 GATCACTTGGTGCCTGACCCTGG - Intergenic
1183977081 22:41518510-41518532 GATCACTTGGTGCCTGACCCTGG + Exonic
1184693649 22:46128404-46128426 GGTCACAGGGGGCCACGGCCAGG - Intergenic
951551631 3:23880518-23880540 GATCACATTGTGCTCCAGCCTGG + Intronic
951776595 3:26317083-26317105 GATCACATGGGGCCTGTTCAGGG - Intergenic
953575662 3:44111303-44111325 GAACACAGGGGCCTTCAGCCTGG - Intergenic
953610531 3:44444049-44444071 GCTCAGATGGGACCTGAGCCTGG + Exonic
954300818 3:49699883-49699905 GGTCACATGGGGCCCTCGCCAGG - Intronic
954709890 3:52500328-52500350 AACCACCTGGGGCCCCAGCCAGG + Intronic
954952996 3:54491422-54491444 GAAAACATGGTGTCTCAGCCTGG + Intronic
956836243 3:73098371-73098393 CAGTACCTGGGGCCTCAGCCTGG - Intergenic
961630953 3:128297991-128298013 CATCACATGTGCCCTCAGGCAGG + Intronic
961654230 3:128432777-128432799 GATCACCTGGGTCCTCCTCCAGG - Intergenic
962607414 3:137044359-137044381 GATCTGATGGGGCCTCTGTCTGG - Intergenic
965991107 3:174819149-174819171 GATCACTTGAGCCCTGAGCCTGG - Intronic
966230789 3:177649248-177649270 GATCAATTGGAGCCTCAGTCAGG + Intergenic
968461824 4:730051-730073 GGGCACCTGGGGCCTCAGACAGG - Intronic
968688933 4:1980050-1980072 GATCACATGTGCCCTCTGCCAGG + Exonic
969161180 4:5260518-5260540 GATCAAATGGTGCCTCCTCCAGG - Intronic
969218601 4:5744306-5744328 AATCACATATGGCCTCAGCTTGG + Intronic
982878863 4:160685803-160685825 CCTCTCATGGGGCCCCAGCCAGG + Intergenic
992008154 5:72499868-72499890 GACAAAATGGGGCCTCTGCCTGG - Intronic
995341996 5:111070746-111070768 TGTCACCTGGGGCCTCAGCCCGG - Intronic
997303328 5:132822313-132822335 GTTCTCATGTGGCCTCACCCAGG - Exonic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1004641808 6:17522953-17522975 GATCACCTGAGGTATCAGCCAGG - Intronic
1007433371 6:41789299-41789321 GACCTCATGGCACCTCAGCCAGG + Exonic
1016949690 6:149567117-149567139 CATCCCCTGGGGACTCAGCCCGG + Intronic
1017958345 6:159198965-159198987 CATCCCAGGGGGCATCAGCCAGG + Intronic
1019542840 7:1559323-1559345 CAGCTCATGGGCCCTCAGCCGGG - Intronic
1020284283 7:6668084-6668106 GATCACCTGAGGTCTTAGCCTGG + Intergenic
1021840995 7:24721800-24721822 GATCACATGGGGCCTCAGCCTGG - Intronic
1024164075 7:46712746-46712768 GAGCACATTGTGCCTCAGCCAGG + Intronic
1029386543 7:100247304-100247326 GTTGACATGTGCCCTCAGCCTGG + Intronic
1032115422 7:129112704-129112726 GATCACATTGTGCTCCAGCCTGG - Intergenic
1033608583 7:142944775-142944797 GATCAGGAGAGGCCTCAGCCTGG + Intronic
1035308733 7:157951809-157951831 GATCAGGTGGGGCCTGAGTCCGG + Intronic
1035480611 7:159179631-159179653 GGTCACATGCGGTCTCTGCCTGG - Intergenic
1035601926 8:902255-902277 GATACCATGGGGGCTCAGCGAGG - Intergenic
1038779401 8:30557397-30557419 GATCTCGTGGGGCCTCATCCTGG + Intronic
1040035611 8:42867027-42867049 GAACACATGAGGGCTAAGCCAGG - Intronic
1040434427 8:47376366-47376388 GATGACAAGGGACCCCAGCCAGG + Intronic
1041621375 8:59973958-59973980 GGTAACATGGGGCCTGACCCAGG - Intergenic
1049710776 8:144062401-144062423 GATCATCTGGGGCCTCAGCTGGG - Intronic
1050131132 9:2413976-2413998 AATCGCATGGGGCCTGAGACTGG + Intergenic
1051744326 9:20280447-20280469 GATCACAGGAGGCACCAGCCTGG + Intergenic
1059417693 9:114172074-114172096 GATAGCATGGGGCCTGAGACAGG - Intronic
1062573127 9:137194609-137194631 GTGCACATGGGCCCTGAGCCTGG + Intronic
1062685801 9:137812534-137812556 GATCTCACGGTGGCTCAGCCAGG + Intronic
1062690265 9:137837915-137837937 GAGCCCAGGGGGCCCCAGCCGGG + Intronic
1186026793 X:5321931-5321953 GATCACATGGGGGCTCGGCGCGG - Intergenic
1190041440 X:47075576-47075598 GATCACTTGAGGTCCCAGCCTGG - Intergenic
1190998496 X:55636046-55636068 TTTCACATGGCGCCACAGCCAGG - Intergenic
1196789064 X:119447819-119447841 GATCACTTAGGGCTTGAGCCTGG - Intronic
1199479971 X:148287740-148287762 GAAGACATAGGGGCTCAGCCAGG - Intergenic
1200110317 X:153737603-153737625 GATCACCTGTGTCCCCAGCCAGG + Intronic
1201861218 Y:18599300-18599322 GATCACATGGTGCTTCCCCCAGG - Intergenic
1201872105 Y:18721080-18721102 GATCACATGGTGCTTCCCCCAGG + Intergenic