ID: 1021842163

View in Genome Browser
Species Human (GRCh38)
Location 7:24729613-24729635
Sequence CTGTCTGCACAGAGGCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 277}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021842163_1021842167 -1 Left 1021842163 7:24729613-24729635 CCTTCATGCCTCTGTGCAGACAG 0: 1
1: 0
2: 3
3: 47
4: 277
Right 1021842167 7:24729635-24729657 GGAGGAGTGAACATCAGACAAGG 0: 1
1: 0
2: 3
3: 15
4: 226
1021842163_1021842169 7 Left 1021842163 7:24729613-24729635 CCTTCATGCCTCTGTGCAGACAG 0: 1
1: 0
2: 3
3: 47
4: 277
Right 1021842169 7:24729643-24729665 GAACATCAGACAAGGACTGGAGG 0: 1
1: 0
2: 0
3: 12
4: 197
1021842163_1021842168 4 Left 1021842163 7:24729613-24729635 CCTTCATGCCTCTGTGCAGACAG 0: 1
1: 0
2: 3
3: 47
4: 277
Right 1021842168 7:24729640-24729662 AGTGAACATCAGACAAGGACTGG 0: 1
1: 0
2: 2
3: 15
4: 186
1021842163_1021842170 14 Left 1021842163 7:24729613-24729635 CCTTCATGCCTCTGTGCAGACAG 0: 1
1: 0
2: 3
3: 47
4: 277
Right 1021842170 7:24729650-24729672 AGACAAGGACTGGAGGTAGAAGG No data
1021842163_1021842171 21 Left 1021842163 7:24729613-24729635 CCTTCATGCCTCTGTGCAGACAG 0: 1
1: 0
2: 3
3: 47
4: 277
Right 1021842171 7:24729657-24729679 GACTGGAGGTAGAAGGAGCCTGG 0: 1
1: 0
2: 6
3: 44
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021842163 Original CRISPR CTGTCTGCACAGAGGCATGA AGG (reversed) Intronic
900504155 1:3020938-3020960 GAGTCTGCAGAGAGGAATGAGGG + Intergenic
900822033 1:4897200-4897222 CTGGCTTCACAGAAGCAGGAGGG + Intergenic
901333731 1:8430703-8430725 CACTCTGCACAGAAGCCTGAAGG - Intronic
903268571 1:22173766-22173788 CTGTCTGCAGAGGGGCAGGAAGG - Intergenic
903337987 1:22637598-22637620 GTGTCTCCACAGAGGCATCATGG + Exonic
903829647 1:26166935-26166957 ATGTCTACACAGAGGCATGCAGG + Intergenic
904293705 1:29504191-29504213 TTGGCTGCCCAGAGGCAGGAGGG - Intergenic
905150175 1:35921036-35921058 TTATCTGCACAGAGGAAGGATGG - Exonic
905169827 1:36103133-36103155 CTGTCTTTACATAGGCATGGTGG - Intronic
907898766 1:58718238-58718260 CTGACTGCAAAGGGCCATGATGG - Intergenic
909318285 1:74251109-74251131 CTCTCTGCACAGAGGCATCATGG - Intronic
909318793 1:74255764-74255786 CTGACTGCAAAATGGCATGAGGG - Intronic
909480228 1:76122410-76122432 ATGTCTGCTCAGAGGCAGGCAGG + Intronic
909549718 1:76884188-76884210 CTGTCTGCACAGACACAGGAGGG - Intronic
910080487 1:83336104-83336126 GTGTCTGCAGGGAGGCTTGAGGG - Intergenic
911573231 1:99543058-99543080 CTGTCTGCAAAGAGACAACATGG - Intergenic
912696770 1:111847985-111848007 TTGACTGCACAGTGGCCTGAGGG - Intronic
913218395 1:116639514-116639536 CAGTCTACACAGAGGCAAGAAGG + Intronic
916272683 1:162960587-162960609 TTGACTCCAAAGAGGCATGAGGG - Intergenic
916730656 1:167563836-167563858 CTGCCTGCACAGCTGCATCAGGG - Intergenic
918474192 1:184905550-184905572 ATGTATGCACAGGGGCAAGAAGG - Intronic
919905172 1:202073553-202073575 CAGCCTGCACAGTGGCATGGAGG + Intergenic
920224938 1:204431630-204431652 CTATCTGCACAGAGGGATGTCGG - Intronic
920681692 1:208077864-208077886 CTCTCTGCACAGATGAATGAGGG + Intronic
923190877 1:231619473-231619495 CTGTCTGCCCAGAGACTTGTTGG - Intronic
1062913296 10:1228472-1228494 CTGTCAGCACAGACTCACGAGGG - Intronic
1063218338 10:3943916-3943938 CTGTCATCACAGTGGCAGGAAGG + Intergenic
1063885028 10:10568651-10568673 AGATCTGCACAGAGGCATGGCGG + Intergenic
1065193533 10:23237794-23237816 TTGTCTGCAAAGGGACATGAGGG + Intronic
1065487605 10:26249877-26249899 CTGCCAGGACAGAGGCAGGAGGG + Intronic
1067233529 10:44427855-44427877 CTGCCCTCACAGAGGGATGAGGG - Intergenic
1067517408 10:46963580-46963602 ATGTGTGTACAGAGGGATGAGGG + Intronic
1067644840 10:48088249-48088271 ATGTCTGTACAGAGGGATGAGGG - Intergenic
1068353497 10:55880893-55880915 CAGCCTGCACAGAGCCAAGAAGG + Intergenic
1069259107 10:66371766-66371788 CTGTCTGCAAAGAAGCTCGAAGG + Intronic
1069787596 10:70998567-70998589 CTCTTTGCACAGAGGTATTATGG + Intergenic
1071575585 10:86723494-86723516 TGGTTTGCACAGAGGCATGGAGG + Intronic
1072064087 10:91848518-91848540 CTGGCTGCAGAAAGGCTTGATGG - Exonic
1074541293 10:114367280-114367302 CTGTTTGCAGACAGGCATGTGGG + Intronic
1075098447 10:119489343-119489365 CTGTGTGCACAGAGGCTTAAAGG - Intergenic
1075232366 10:120691339-120691361 CAGTCTGCAAAGGGGCAGGAAGG - Intergenic
1075585572 10:123655580-123655602 CTGCCTGGAAAGGGGCATGAGGG + Intergenic
1076228037 10:128796647-128796669 GTGGCTGCCCAGAGGCACGATGG - Intergenic
1076646517 10:131958198-131958220 CTATCTCCACAGGGGCACGAGGG - Intronic
1077109027 11:854009-854031 CAGGCAGCACAGAGGCCTGAAGG - Intronic
1077152254 11:1077609-1077631 GGGTCTGCCCAGAGGCCTGACGG - Intergenic
1077242090 11:1515901-1515923 CAGCCTTCACAGAGGCACGAGGG + Intergenic
1078867440 11:15311193-15311215 CTGTGTGTACAGAGACATGAAGG - Intergenic
1080253218 11:30259170-30259192 TTAACTGCAGAGAGGCATGAGGG - Intergenic
1081383498 11:42444472-42444494 TGGTCTCCACAGAGGCATTAAGG - Intergenic
1081400666 11:42638454-42638476 TTGTCTGTAAAGAGGCATGAGGG - Intergenic
1081818538 11:45968218-45968240 TTCTCTGCACAGAGGCAAGAAGG + Intronic
1083032989 11:59611320-59611342 CTGACTGCAAAAGGGCATGAAGG - Intronic
1088894363 11:114066632-114066654 CTCTCTCCCCAGAGGAATGAGGG - Intronic
1089182923 11:116595323-116595345 GTGTCTGCCCAGAGGTATCAAGG + Intergenic
1090164132 11:124529075-124529097 ATGTCTACACAGTGGCTTGAAGG + Intergenic
1090950807 11:131471670-131471692 ATATCTGCACAGAAGCATGCCGG + Intronic
1091033526 11:132213168-132213190 CGGTGTGCACAGATGGATGAAGG + Intronic
1092121575 12:6047932-6047954 CTATCTGCACAGAGGCAGAAGGG + Intronic
1092847075 12:12593725-12593747 CTGTTTGTACAGAGTCATGATGG - Intergenic
1093822931 12:23643944-23643966 CTGTCTGCACAGTAGCTTTAGGG - Intronic
1094160801 12:27388227-27388249 CTGGCTGCTCAGGGGCATGTAGG + Intronic
1094434877 12:30410249-30410271 CTGCATGCACACAGGCATGCAGG + Intergenic
1095998764 12:48111998-48112020 GCCGCTGCACAGAGGCATGATGG + Intronic
1096646147 12:53037397-53037419 CTGGCTTCACAGATGCACGAAGG + Exonic
1100784195 12:98062022-98062044 CTGTCTGCCCAGATGCAGAAAGG + Intergenic
1102577185 12:113863170-113863192 GTGTTTGCACACAGGCCTGAAGG + Intronic
1103122168 12:118389372-118389394 CAGTCTCCACAGTGGCAGGATGG - Intronic
1103189988 12:118993180-118993202 CTTTCCCCACAGTGGCATGAGGG - Intronic
1103731688 12:123032087-123032109 CTGGCTGCACAGCTGCAGGAAGG + Intronic
1104628359 12:130378148-130378170 CTGCTTGCAAAGAGGCAAGATGG - Intergenic
1105999933 13:25712286-25712308 CAGTCTGCACAGTACCATGAGGG + Intronic
1106403957 13:29457288-29457310 TTGGCTGGAAAGAGGCATGAGGG - Intronic
1108592187 13:51922053-51922075 CTGCCTGCAGAGAGGTGTGAGGG - Intergenic
1108782657 13:53855562-53855584 CTTTCAGCAGAGAGGCATGTGGG + Intergenic
1110315759 13:74104237-74104259 CTGTTTCCACAGAGGAATAACGG - Intronic
1110332515 13:74288838-74288860 CTGACAGAACAGAGGCAGGAAGG - Intergenic
1110916463 13:81027209-81027231 TTGACTGCAAAGGGGCATGAGGG - Intergenic
1112959753 13:105108948-105108970 CTGTCTTGACAGATGCATAATGG + Intergenic
1113161150 13:107382588-107382610 CTGACATCACAGAGGCATTAAGG - Intronic
1113174460 13:107546200-107546222 CTGTCTGCAGAGCAGCAGGATGG - Intronic
1115523803 14:34259329-34259351 CTGTCTGCAAAGAGGAAAGTGGG + Intronic
1115793430 14:36905669-36905691 CTTTGTGCACAGAGGTCTGAAGG + Intronic
1116179925 14:41519789-41519811 GCGGCTGCACAGAGACATGATGG - Intergenic
1118798671 14:69168746-69168768 CTTTCTGTACAGAGGAAGGAAGG - Intergenic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1121291215 14:92777140-92777162 CCTTCTGCCCAGAGGCAAGAAGG - Intergenic
1121586739 14:95067963-95067985 CAGGCTGCACAGAGGCTGGAAGG - Intergenic
1121709443 14:96026745-96026767 ATGTCTTCACGGAGCCATGAAGG + Intergenic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1122048734 14:99041161-99041183 CGGCCTCCACAGATGCATGAAGG - Intergenic
1122113657 14:99517404-99517426 CTGATAGCACAGAGGCAAGAGGG + Intronic
1122485807 14:102078913-102078935 GTGACTGCAGAGAGGCAAGAAGG - Intergenic
1125401787 15:39311899-39311921 CAGACTGCACACATGCATGAGGG - Intergenic
1125436831 15:39654885-39654907 TTGTCTGCCCAGAGGCTTAAAGG + Intronic
1126745721 15:51824623-51824645 CTGTATGCACACAGGCGTGGTGG + Intergenic
1126979547 15:54226806-54226828 GTGTCTGGACAGAGGGATCATGG + Intronic
1128574969 15:68767552-68767574 CTGATTGAAAAGAGGCATGAGGG - Intergenic
1129231426 15:74199172-74199194 CTGTATGAAGAGAGGCATCAAGG + Intronic
1129996622 15:80012138-80012160 TCGGCTGCACAGGGGCATGAGGG + Intergenic
1131082556 15:89548886-89548908 GTGACTGCATAGGGGCATGAAGG + Intergenic
1131297291 15:91161158-91161180 GTGACTGCAAACAGGCATGATGG + Intronic
1131621649 15:94074156-94074178 CTGGTTTGACAGAGGCATGAGGG + Intergenic
1131684396 15:94754402-94754424 GCCTCTGCACAGAGACATGATGG - Intergenic
1132919299 16:2376631-2376653 CTCTCTGGAGAGAGGGATGAGGG - Intergenic
1133205677 16:4232083-4232105 CTGTCTACACAGAGGCAGAGCGG - Intronic
1133277294 16:4646702-4646724 CAGTCTGCCCAGAGACATGTCGG + Intronic
1134466517 16:14483651-14483673 CTGTCTAAAAACAGGCATGAGGG - Intronic
1136547996 16:30966075-30966097 CTATATGCACAGGGGCAGGAGGG + Exonic
1136576075 16:31126199-31126221 CTGTTTGTGCAGAAGCATGAAGG + Intronic
1138194090 16:55039967-55039989 ATGGCTGGACAGAGGCAAGAGGG - Intergenic
1138202707 16:55101821-55101843 CTTTCTCCACTGAGGCTTGATGG + Intergenic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1140258046 16:73353633-73353655 CTCTCTGCAGAGGGGCAGGATGG - Intergenic
1141517031 16:84552365-84552387 CTGTCTGCACAGAGGTATTTGGG - Intronic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1143027023 17:3946990-3947012 TCGACTGCACAGAGTCATGATGG + Intronic
1143456993 17:7074690-7074712 TGGACTGCCCAGAGGCATGAGGG + Exonic
1145907517 17:28524491-28524513 CTGTCTACCCAGAAGCATGCCGG + Exonic
1147783941 17:42964526-42964548 TTGTCTGCGCAGAAGCAGGAGGG + Intronic
1148444093 17:47727269-47727291 CTGTCTGCTGAGAGGCAGGAAGG + Intergenic
1150125160 17:62630468-62630490 CTGTCTGGAGAGAGGCAGGAAGG + Intronic
1152095711 17:78270464-78270486 CTGTCTTCTAAGAGGCAAGATGG + Intergenic
1152199377 17:78936120-78936142 CTGTCGGCACAGGGGGCTGAAGG + Intergenic
1152771447 17:82172143-82172165 CCCTCTGCACAGAGGCACGTGGG - Intronic
1155013999 18:21814036-21814058 CTGCCTGCACTGCGCCATGAAGG - Intronic
1156446138 18:37238357-37238379 CTGACTGAGCAGAGGCATCAGGG - Intergenic
1156577741 18:38338183-38338205 CTGTCTCCCCAGAGGCTTTAGGG - Intergenic
1157273964 18:46297142-46297164 CTGTGTACACATAGCCATGAGGG + Intergenic
1157409490 18:47451905-47451927 CTGTCTGCACAGAAGGTAGAAGG + Intergenic
1157601024 18:48893347-48893369 CTCTCGGAACAGAGCCATGAGGG - Intergenic
1157847978 18:51021451-51021473 CTGACTGCAAAGGGGCATAAGGG + Intronic
1157933614 18:51850192-51850214 TTGACTGCAAAGAGGCATGAGGG - Intergenic
1159550093 18:69885766-69885788 CTGTCCACACAGTGCCATGAGGG - Intronic
1159574143 18:70155650-70155672 CAGTCTGCACAGAGCCCAGAGGG + Intronic
1160158435 18:76451499-76451521 CTGTCTGCAAAGGCGTATGATGG + Intronic
1162971934 19:14185947-14185969 CTATCTGAGCAGAGGCCTGAAGG - Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1164561870 19:29297999-29298021 CTGGATGCACAGAGGCATTGAGG + Intergenic
1164625640 19:29725902-29725924 GGGACTGCACAGAGGCATGAAGG + Intergenic
1165061716 19:33208062-33208084 CTGCCTGGCCAGGGGCATGAGGG - Exonic
1165991754 19:39819270-39819292 TAGTCTGCACAGAGGAAGGAGGG - Intergenic
1166606520 19:44148213-44148235 TTGTGTGCACTGAGGCATGATGG + Intronic
1167909353 19:52689566-52689588 CTGGATGTACAGAGACATGAAGG - Intronic
1168689161 19:58366571-58366593 CCATCTGCACAGTAGCATGAGGG + Intergenic
925043090 2:748876-748898 GTGTCTGCATAGAGGCCTGTGGG + Intergenic
925043098 2:748951-748973 GTGTCTGCATAGAGGCCTGTGGG + Intergenic
925302175 2:2825299-2825321 CTGACAGCACAGAGGCACGCAGG + Intergenic
926444102 2:12923005-12923027 TAGTATGAACAGAGGCATGATGG + Intergenic
929084656 2:38156481-38156503 CAGTCTGCACAGAGACATGGGGG + Intergenic
930953991 2:57181464-57181486 TTATCTACAAAGAGGCATGAGGG + Intergenic
934887288 2:98035967-98035989 CTGACTGCAGAGAGGCTAGAGGG + Intergenic
934967881 2:98738619-98738641 CGGTGTGAACAGAGGCATCATGG + Intergenic
939680912 2:145130732-145130754 CTGTTTGGACAAAGGCATGCAGG + Intergenic
941101666 2:161303128-161303150 TTAACTGCACAGGGGCATGAGGG - Intergenic
942334440 2:174867588-174867610 CTTTATGAACAGAGCCATGATGG + Intronic
942672523 2:178391148-178391170 CTGTTTGGAAAGTGGCATGAAGG + Exonic
943611103 2:190035566-190035588 CTGACTACAAAGTGGCATGAGGG - Intronic
944204586 2:197144169-197144191 CTGTCTGCTCAGAGGCATTCAGG + Intronic
944314112 2:198267130-198267152 CAGTCTCCCCAGAGGCTTGAAGG + Intronic
946984138 2:225252611-225252633 TTGTCAGGAAAGAGGCATGAGGG - Intergenic
947971446 2:234328668-234328690 CTGTTTGCACAGCGGACTGAGGG + Intergenic
948690875 2:239704197-239704219 GTGTCTACACAGAGAAATGATGG - Intergenic
1168789150 20:564271-564293 TCATCTGCACAGAGGCCTGAAGG + Intergenic
1170346477 20:15392564-15392586 CTGTTGGTAAAGAGGCATGATGG - Intronic
1173875366 20:46367163-46367185 CTGTCTACTAAGAGTCATGAAGG - Exonic
1174051155 20:47768534-47768556 CTGTGTGAACAGAGGCCTCAGGG + Intronic
1174065243 20:47860023-47860045 GTGGCTGCAGAGAGGCAGGATGG - Intergenic
1175226323 20:57446091-57446113 CTGACTGCAAAAATGCATGAGGG - Intergenic
1176025753 20:62984746-62984768 CCGGGTGCACAGAGGCTTGAAGG + Intergenic
1177262146 21:18743996-18744018 TTCTCAGCACAGAGGCTTGAGGG - Intergenic
1180819696 22:18817594-18817616 CGGTCTACACAGAGGCAAGAAGG + Intergenic
1181137361 22:20777897-20777919 CTTTTAGCACAGAGGCATTATGG - Intronic
1181205921 22:21252039-21252061 CGGTCTACACAGAGGCAAGAAGG + Intergenic
1181460727 22:23084535-23084557 CTGTCTGCAAGAAGGCCTGATGG - Intronic
1182059761 22:27388524-27388546 CTCTCTGAACAGAGACAGGAAGG + Intergenic
1182176560 22:28295630-28295652 CTGTCTGCAGAGTGGAAAGAAGG - Intronic
1182443287 22:30376426-30376448 CTGTCTGCCCAGAGGCCTGAAGG - Exonic
1182557758 22:31138240-31138262 CTGTCTGGAAAGGGACATGAGGG + Intronic
1183330147 22:37215129-37215151 ATGTATGCACCGAGGCATAAGGG - Intergenic
1184080280 22:42214521-42214543 CAGTCTGGACAGAGCTATGATGG - Exonic
1184232261 22:43164659-43164681 CTGTCTGCACAGAGCTCTGGAGG - Intergenic
1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG + Intronic
1184677130 22:46049894-46049916 TTGTCTGTACAGGGGGATGAAGG - Exonic
1185009081 22:48303106-48303128 CTGTCTGCTCCAAGGCCTGAAGG - Intergenic
1185164316 22:49251421-49251443 CTGACCGGACACAGGCATGAGGG + Intergenic
1185392741 22:50571398-50571420 CGATCTGCACAAAGGCATCAGGG + Exonic
1203221000 22_KI270731v1_random:43374-43396 CGGTCTACACAGAGGCAAGAAGG - Intergenic
1203269825 22_KI270734v1_random:43447-43469 CGGTCTACACAGAGGCAAGAAGG + Intergenic
950834305 3:15904511-15904533 CTGTCTGCACTCATGAATGAAGG + Intergenic
952341655 3:32452280-32452302 CTTTCTGGCCAGAGACATGAAGG + Intronic
952815865 3:37447236-37447258 CTCTCTGCAGTGAGGCAGGAGGG + Intergenic
952852668 3:37741718-37741740 CTCTCTGCACAGTGGCAACACGG + Exonic
953775593 3:45814158-45814180 CTGGCTGCAAAGGGACATGAAGG + Intergenic
953782042 3:45880016-45880038 CTGCCTGTACGGAGGCATCATGG - Intronic
953835124 3:46336053-46336075 CTGTCTGAATATGGGCATGAGGG + Intergenic
955120156 3:56050060-56050082 CTGACTGCAAAGGGGCATGAGGG + Intronic
956128023 3:66029313-66029335 CTTTATGGACAGGGGCATGATGG - Intronic
959087904 3:101870595-101870617 TTGACTGCAAAGGGGCATGAAGG - Intergenic
960942491 3:122943757-122943779 CCCTCCCCACAGAGGCATGAAGG + Intronic
961186333 3:124918331-124918353 CTGTGAGCTCAGAGGCATGGAGG - Intronic
961911759 3:130324629-130324651 CTGGCTGAAGAGGGGCATGAGGG + Intergenic
962529440 3:136265339-136265361 CTGACTGCAAACAGGCAAGAAGG - Intronic
965475227 3:169147833-169147855 GTGTGTGCACCGAGGCAGGAGGG + Intronic
965553303 3:169992693-169992715 ATGTGTGTACAGAGGCCTGAAGG - Exonic
966504502 3:180684523-180684545 CTGACTGGAAAGAGGCATGAGGG - Intronic
968943359 4:3650976-3650998 CTGTCTGCACGCAGGGATGCCGG - Intergenic
969388349 4:6871988-6872010 TTGCCTGCACAGAGGCAGGAGGG + Intronic
970356511 4:15258994-15259016 CTGTATGCACAAATGCATGAAGG - Intergenic
970742320 4:19252322-19252344 CTGTTGGCACAGAGTCAGGAGGG - Intergenic
971328152 4:25661241-25661263 CTTTATGCTCAGAGGCATAAAGG + Intronic
972921002 4:43941699-43941721 CAGTCTGCAGAGAGGCAGGAAGG - Intergenic
974243108 4:59277938-59277960 CTCTCAACAAAGAGGCATGAAGG + Intergenic
974972804 4:68850298-68850320 TGGACTGCAAAGAGGCATGAAGG + Intergenic
975313493 4:72928020-72928042 CTGGCTGTACAGTGGCATGGAGG + Intergenic
976782280 4:88774153-88774175 ATGCTTGCACAGAGGCCTGAAGG - Intronic
979350140 4:119634506-119634528 TTGACTGCGAAGAGGCATGAGGG + Intergenic
982839860 4:160170524-160170546 CAGTCTGCTCAGAGGAATGAGGG - Intergenic
983572021 4:169219638-169219660 CTGCCTGCAAATAGGCCTGAAGG - Intronic
985697797 5:1351182-1351204 CTGGCTGCAAAGGGGCAAGAAGG - Intergenic
986034471 5:3924798-3924820 CTATCTGCATAGAGCCATGACGG + Intergenic
991519644 5:67481485-67481507 CTGTTCACACAGAGACATGATGG - Intergenic
992810027 5:80377389-80377411 CTGTCTGGAAAGAGGAAGGAAGG + Intergenic
992946483 5:81816321-81816343 TTTACTGCACAGAGGCATGTAGG - Intergenic
994920846 5:106040890-106040912 CTGTCTCCACATTGGCATGGAGG - Intergenic
996284553 5:121773328-121773350 GTGTTTGGAAAGAGGCATGAGGG - Intergenic
997296737 5:132773299-132773321 CTGGCAGCACAGAGGCAGGAAGG + Intronic
998466891 5:142353793-142353815 ATGGCTGGGCAGAGGCATGAGGG - Intergenic
998923402 5:147095972-147095994 GTGGCTGCAAAGAGGCAGGAGGG + Intergenic
999148550 5:149411896-149411918 CTGTGTGCCCAGAGGGATAATGG - Intergenic
1000186119 5:158859690-158859712 CAGTATGCACAGAGGCTTGAAGG - Intronic
1000469627 5:161624384-161624406 CTGACTGAAAAGGGGCATGAGGG + Intronic
1002349300 5:178571726-178571748 CTTTCTGCACATAGGCAGTACGG - Intronic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1004601032 6:17150153-17150175 CTGTCCTCACACAGGCATGACGG + Intergenic
1005379204 6:25216688-25216710 CTGTCTGCATAGGGGAATAAAGG - Intergenic
1005414704 6:25587394-25587416 GTGTCTGGACAGAGGCTTGTGGG + Intronic
1005485342 6:26294027-26294049 CTCTCTGCCCAGAGGTCTGATGG + Intergenic
1005897335 6:30189427-30189449 CTCTCTGCAACGAGGCCTGAGGG - Exonic
1006358537 6:33574580-33574602 CTGTCATCACAGTGGTATGAAGG + Intronic
1006574226 6:35032224-35032246 CTGACTGCAGAGAGGCCTCATGG - Intronic
1007351050 6:41273767-41273789 CTGTTTGCTGAGAGGCTTGAAGG + Intronic
1008052141 6:46911118-46911140 CTCTCTACAGAGAGGCAAGATGG + Intronic
1009032779 6:58080833-58080855 CAGTCTGCACAGAGCCTGGAGGG + Intergenic
1009303006 6:62051120-62051142 CTGGCTGGAAAGCGGCATGAAGG + Intronic
1009511568 6:64556490-64556512 TTGACTACACAAAGGCATGAGGG + Intronic
1012992088 6:105936266-105936288 ATTTCTTCACAGATGCATGAAGG + Intergenic
1013488346 6:110619463-110619485 TTGTCTGCAAAGAGGCTGGAGGG + Intronic
1013614361 6:111827904-111827926 CTAACTGCACAGAGGCAGGCAGG + Intronic
1013805865 6:113995157-113995179 ATGTCTGCACAGAGCCTTGAAGG - Intronic
1013807353 6:114010685-114010707 CTGTCTACACACAGGGATCAGGG + Intronic
1014275650 6:119385261-119385283 TGGTCTACACAGAGGTATGAAGG + Intergenic
1014371684 6:120617019-120617041 CTGTCTACACTGTTGCATGAAGG - Intergenic
1014925661 6:127267134-127267156 CTGTCCGCGCAGAGGCGGGATGG + Intronic
1016286344 6:142477468-142477490 CTGTCTGCACAAAAGTATGGCGG + Intergenic
1016556976 6:145349787-145349809 CTGTCTGAAGAGAAGCAGGATGG + Intergenic
1017445664 6:154505148-154505170 CTGTCTGGACGGTGGCAGGAAGG + Intronic
1017563780 6:155662562-155662584 CTGTCTACACATAGTCATGCAGG + Intergenic
1017683911 6:156892668-156892690 CTGGCTGGAAAGAGACATGAAGG - Intronic
1018335367 6:162781422-162781444 GTGTCTACACAGAGGAAAGAAGG + Intronic
1018909187 6:168092164-168092186 CCGTCTGCTCTGAGGCTTGATGG + Intergenic
1021402774 7:20228726-20228748 CTGTGTGAACATAGTCATGAAGG - Intergenic
1021842163 7:24729613-24729635 CTGTCTGCACAGAGGCATGAAGG - Intronic
1023873876 7:44276563-44276585 CTCCCTGCCCAAAGGCATGATGG - Intronic
1024295584 7:47839498-47839520 CTGTCTGCCGGCAGGCATGATGG - Exonic
1026520669 7:71115235-71115257 TTGACTGCAGAGGGGCATGAGGG + Intergenic
1026902598 7:74045302-74045324 CTGTCTGGACAGAGGGCTGATGG + Intronic
1027012336 7:74756895-74756917 CTGCCTGCACAGTGGCACAATGG + Intronic
1029111257 7:98214053-98214075 ATCTCTGGGCAGAGGCATGAGGG - Intergenic
1029379243 7:100201926-100201948 CTGTGGGCACAGTGGCTTGAAGG - Exonic
1029610707 7:101625207-101625229 CTGACATCACAGAGGCAGGAAGG - Intronic
1029622617 7:101699390-101699412 CTGTCTGCCTATTGGCATGAAGG - Intergenic
1029793893 7:102873809-102873831 CAGCCTGCACAAAGGCATGGAGG - Intronic
1031300487 7:120057243-120057265 CTGTTTCCACACAGTCATGAAGG + Intergenic
1031840242 7:126728946-126728968 CTGTGTGAACAGAGACCTGAAGG - Intronic
1032072811 7:128819282-128819304 CTGGCTGCACAGGTGCATGTTGG - Intronic
1032421036 7:131779309-131779331 TTGGCTGCAAAGAGGCATGAGGG - Intergenic
1033538358 7:142332604-142332626 TTCTCTGCACAGAGGTCTGAGGG + Intergenic
1033556503 7:142492576-142492598 TTCTCTGCAGAGAGGCCTGAGGG + Intergenic
1033558869 7:142512030-142512052 TTCTCTGCAGAGAGGCCTGAGGG + Intergenic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1036748745 8:11429694-11429716 CTGTCTGCTCAGAGGCGAGCTGG + Intronic
1037360297 8:18066976-18066998 TTTTCTGCAAAGGGGCATGATGG + Intronic
1037668490 8:20994352-20994374 GTGTCTATACAAAGGCATGATGG + Intergenic
1038104204 8:24414964-24414986 CTGTGGGCACAGAGGCCTGTGGG - Intergenic
1038291136 8:26250934-26250956 TTGACTGCACAGAGGCACAAAGG + Intergenic
1038307115 8:26414813-26414835 CTGGCTGCACTGGGGAATGAAGG - Intronic
1038516501 8:28191893-28191915 CTGTCTGCTCCGAGGCCTGTGGG + Intergenic
1038941306 8:32308917-32308939 CTGTCTTCACTGAGGTGTGATGG - Intronic
1039421575 8:37447761-37447783 CTGACTGCAAAGAGGCATGAAGG + Intergenic
1041202108 8:55460285-55460307 TTGACTGCAAACAGGCATGAGGG + Intronic
1041381597 8:57258848-57258870 CTGGCTGCACAAAGGGTTGAGGG - Intergenic
1045499425 8:102733577-102733599 CTGTATGCACACAGGTATGGAGG + Intergenic
1047429182 8:124776030-124776052 CAGCCTGCAGAGAGTCATGAAGG - Intergenic
1047495307 8:125404818-125404840 CTGTGTGCACAGAGCCATCGAGG - Intergenic
1049010006 8:139881039-139881061 TTGTGGGCACAGAGGCATGTTGG - Intronic
1049153560 8:141052760-141052782 GCGTCTGCACAGAGGCAGAATGG - Intergenic
1049230860 8:141480449-141480471 CTGTCAGCAGAGGGGCATGGGGG + Intergenic
1049599212 8:143499252-143499274 TTCTCTGGACAGAGGGATGAGGG + Intronic
1049905439 9:212454-212476 CTCTCTGGACAGAGGGCTGATGG + Intergenic
1050755384 9:8996480-8996502 TTGACTGCAAAGAGGAATGAAGG + Intronic
1051157037 9:14159564-14159586 CTGCCTGCAGAGATGCATGAAGG - Intronic
1054934687 9:70674109-70674131 CTGTCTGCCCACAGGAAAGAGGG + Intronic
1057477087 9:95411952-95411974 ATGTCTGCACAGAGACTGGACGG + Intergenic
1059393653 9:114017160-114017182 CAGTCTGAACAGATGCATGAAGG + Intronic
1059397161 9:114042868-114042890 ATGACTGCAAAGGGGCATGAAGG - Intronic
1059792947 9:117660410-117660432 CTGCCTCCACAGAGGCAGCATGG - Intergenic
1059902640 9:118945346-118945368 CTGTGTGCACAGAGCCAGCACGG + Intergenic
1061034947 9:128108204-128108226 CTGTCCCCACTGTGGCATGAGGG + Exonic
1062401463 9:136374556-136374578 TTGTCCGCACAGAGGCCTGAGGG - Intergenic
1062504991 9:136868882-136868904 CTCCCTGCACCAAGGCATGATGG + Intronic
1062721648 9:138047298-138047320 CTGACTGCTCAGAGGCCTGGAGG + Intronic
1187697540 X:21937172-21937194 CTGTCTGCTCAGAAGCAAGTGGG + Intergenic
1189092355 X:38099011-38099033 CTGACTGCAAACAGGCATGGGGG + Intronic
1192855270 X:75003466-75003488 GTGTCTCCACATAAGCATGAGGG + Intergenic
1196053834 X:111333871-111333893 CTTTCTGCACAAAGAGATGAGGG + Intronic
1197171863 X:123443677-123443699 GTGTCTGTACAGAGGCTTCAGGG + Intronic
1197857064 X:130925752-130925774 CTGACTGCACAGGGGCACAAGGG - Intergenic
1199366479 X:146991006-146991028 TTGTCTGCAAATAGGCATAAGGG + Intergenic
1199400174 X:147389719-147389741 CTGTCTGAACACATGCATGCTGG - Intergenic
1200161373 X:154011576-154011598 CTGGCTGCACAGACCCGTGAGGG - Exonic
1200443743 Y:3238564-3238586 CTGTTTCCACACAGTCATGAAGG + Intergenic
1201421264 Y:13802344-13802366 AAGTCTGCACTGAGCCATGATGG - Intergenic
1201581589 Y:15516009-15516031 GTCACTGCACAGAGACATGATGG - Intergenic
1202168522 Y:22017090-22017112 CTGTTTCCACAGAGTCATGAAGG - Intergenic
1202222839 Y:22569278-22569300 CTGTTTCCACAGAGTCATGAAGG + Intergenic
1202320276 Y:23626382-23626404 CTGTTTCCACAGAGTCATGAAGG - Intergenic
1202550491 Y:26043674-26043696 CTGTTTCCACAGAGTCATGAAGG + Intergenic