ID: 1021842547

View in Genome Browser
Species Human (GRCh38)
Location 7:24732628-24732650
Sequence AGGGAGAGCACAGCAACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 2, 1: 17, 2: 44, 3: 125, 4: 384}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021842545_1021842547 -9 Left 1021842545 7:24732614-24732636 CCGTGTGCTGTAGGAGGGAGAGC 0: 1
1: 0
2: 0
3: 34
4: 278
Right 1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG 0: 2
1: 17
2: 44
3: 125
4: 384
1021842541_1021842547 13 Left 1021842541 7:24732592-24732614 CCATGTGGCAGAGAGAGAGAAGC 0: 1
1: 0
2: 15
3: 77
4: 475
Right 1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG 0: 2
1: 17
2: 44
3: 125
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021842547 Original CRISPR AGGGAGAGCACAGCAACTGT GGG Intronic
900938844 1:5784790-5784812 AGGGGGACCAGGGCAACTGTTGG - Intergenic
902274621 1:15330622-15330644 AGGGAGAGCAGGGCATCTGCAGG + Intronic
902383657 1:16064465-16064487 AGGGAGAGCAGAGCCTCTGGGGG - Intronic
905285718 1:36879031-36879053 AGGGAGAGAAGAGCCACTGAGGG - Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
906581827 1:46941268-46941290 AGGGAGGGCACGGGAACTGCTGG + Exonic
906601890 1:47137629-47137651 AGGGAGGGCACGGGAACTGCTGG - Exonic
907764782 1:57398354-57398376 AGGGAAAGGAGAGCAACTGATGG + Intronic
907795165 1:57708733-57708755 AGAGAGAGCAAAGCAAGAGTGGG - Intronic
909663707 1:78111089-78111111 ATGGAAAGTACAGAAACTGTTGG + Intronic
910066005 1:83151510-83151532 AGGGAGATCACTGCAAGTGAAGG - Intergenic
910188475 1:84571219-84571241 AGGCAGAATACAGAAACTGTTGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911236732 1:95420182-95420204 AGGGGGAGCAGAGCAGTTGTTGG + Intergenic
912096985 1:106157935-106157957 AGGGAGAGATCAACAACAGTTGG + Intergenic
912181764 1:107227234-107227256 AGTGAGGGCTCAGCAAATGTTGG + Intronic
912239260 1:107887795-107887817 AAGGAGATCAAAGCACCTGTGGG - Intronic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
913469010 1:119171693-119171715 AAGTAGAGCACAGCAGCTGCTGG - Intergenic
913470198 1:119179212-119179234 AAGTAGAGCACAGCAGCTGCTGG - Intergenic
915069907 1:153258173-153258195 AGGGAGAAGACAGGATCTGTTGG - Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917300675 1:173570832-173570854 AGGGAGACCACAGCAACTGGGGG - Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917373210 1:174317941-174317963 AGGGAGAACACAGCAACTGTGGG - Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918070707 1:181131715-181131737 AGGGTGAGCTCAGCACCTGGCGG - Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919012934 1:191988480-191988502 AGGGAGAACACAGCAACTGGGGG + Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919169705 1:193938553-193938575 GGGGAGAGTGCAGCAATTGTGGG + Intergenic
919262521 1:195215819-195215841 AGGGAGAGCACAGATAATTTAGG - Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
921184469 1:212657691-212657713 AGGCAGAGCACAGCCTCAGTTGG - Intergenic
922139286 1:222866131-222866153 AGGGTGAGCAGAGGAACTGTTGG + Intergenic
922358226 1:224796460-224796482 AGGGATAGCATGGCAACAGTGGG - Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
922789096 1:228300196-228300218 TGGGAGAGCACAGAACATGTGGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1064318234 10:14277689-14277711 AGGGAGGGGAAAGTAACTGTGGG - Intronic
1065374462 10:25024090-25024112 AGAAAGAGCACAGATACTGTTGG + Exonic
1065495042 10:26318977-26318999 AGGGCGAGCACAGGACCTGCAGG + Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1066981375 10:42419362-42419384 ATGGAGAGCACAGCAACTGTGGG - Intergenic
1067669104 10:48303508-48303530 AAGGAGAGAAGAGGAACTGTAGG - Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1070059556 10:72968675-72968697 AGGGAAAGTACAGTAACTGGGGG - Intergenic
1070147413 10:73785296-73785318 CAGGAGAGGACAGCAACTATTGG - Intergenic
1070819785 10:79347994-79348016 AGGGAGGGCTCAGCACCTCTGGG + Intronic
1071935635 10:90527061-90527083 AGGGAGAGTACAGGATTTGTGGG - Intergenic
1072058668 10:91787387-91787409 AGGAAGAGCACAGCAATTGTAGG + Intergenic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1073870789 10:107861868-107861890 AGGGAGAGCTCAGCAGCTTTGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075568823 10:123523897-123523919 AGGAAGAGCTCAGCAAATGGTGG + Intergenic
1075739424 10:124685327-124685349 AGCAAGGGCACAGCACCTGTGGG - Intronic
1077842471 11:5990657-5990679 AGGGAGGGCACAGAAAGAGTGGG + Intergenic
1078190127 11:9087315-9087337 AGAGAGCACACAGCAACTGGAGG + Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080489963 11:32751588-32751610 AAGGAGAGTGCAGCAATTGTGGG - Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1082907875 11:58331583-58331605 AAGGACAGCTCAGAAACTGTTGG - Intergenic
1083512887 11:63227935-63227957 AGGAAGAGCACAGCAATTACGGG - Intronic
1083953583 11:65970552-65970574 GGGGAGGGCACAGCAGCTGTGGG + Intronic
1084045785 11:66567109-66567131 AGGGAGAGCTCAGGAATTATGGG + Intronic
1084813629 11:71631766-71631788 AAGTCGAGCACAGCAACTGCTGG + Intergenic
1085194851 11:74662957-74662979 AGGGAGAGTGCAGCAACTGTGGG - Intronic
1085223332 11:74895259-74895281 ATGGAGAGCACAGCAACCGAGGG + Intronic
1085237551 11:75026596-75026618 GGGGAGAGCACAGCTGCGGTTGG - Intergenic
1085379803 11:76105136-76105158 AGATAGATCACAGAAACTGTGGG + Intronic
1085416132 11:76320204-76320226 AAGGACAGCACAGGAACTATGGG - Intergenic
1085459427 11:76684592-76684614 AGGGAGAGCACAGCAACAAGGGG - Intergenic
1086032990 11:82383213-82383235 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1086249837 11:84799327-84799349 AGGAAGAGCACAGCAGCTGGAGG - Intronic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087614282 11:100470472-100470494 AAGGAGGGCACAGAAACTGAGGG + Intergenic
1088009722 11:104985679-104985701 AGGGAGAGTACAGCATCTGAGGG + Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1091348692 11:134874970-134874992 AGAGAGGGCAAAGCCACTGTGGG - Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093581730 12:20791194-20791216 AGGGAAAGAACAGCAACTGGGGG - Intergenic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095196362 12:39323266-39323288 CAGGAGAGCACAGTAAATGTTGG - Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1097288003 12:57892471-57892493 TGGGAGAGGAGAGCAGCTGTGGG + Intergenic
1098395201 12:70010213-70010235 AGGGACAGCACAGCAACTGTAGG + Intergenic
1098953550 12:76665984-76666006 AGGGAGAGCACATCAGCATTAGG - Intergenic
1099024395 12:77447602-77447624 AGGGAGAACAAAGCAATTGCAGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099764263 12:86961627-86961649 AGGGAGAACACAGCATTTGGGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1103272902 12:119688294-119688316 AAGGTGAGCACAGCAACTTCTGG - Intronic
1103341135 12:120221763-120221785 AGGGTGGGCACAGCATCAGTGGG + Intronic
1107210756 13:37851829-37851851 AGGGAGAGCACAGCAACAGGTGG + Intronic
1107524317 13:41214709-41214731 AGGGAAAGCACAGCAATTTTGGG - Intergenic
1107684526 13:42883699-42883721 ATGGAGAGAACAGAAACTGATGG - Intergenic
1107803463 13:44132115-44132137 AGGGATAGGACAGTAACTGCAGG + Intergenic
1107871697 13:44752467-44752489 AGTGACAGCTCAGCAAATGTTGG + Intergenic
1107932894 13:45320993-45321015 AGAGAGAGCACACTAAGTGTTGG + Intergenic
1110665098 13:78107413-78107435 AGGGACAGGAATGCAACTGTGGG - Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1111750496 13:92325423-92325445 AGGAATAACACAGCAACTGTGGG - Intronic
1112710884 13:102127930-102127952 AGTGGGAGCAGAGCAAGTGTAGG - Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113602830 13:111582862-111582884 AGGGAAAGCACAGCAGCTGGGGG - Intergenic
1114155559 14:20099385-20099407 AATTAGAGCACAGCAACGGTGGG - Intergenic
1114416231 14:22546368-22546390 AGGGCTGGCTCAGCAACTGTCGG + Intergenic
1114700937 14:24678334-24678356 ACTGAGAGCACAGCAACCCTGGG + Intergenic
1114985249 14:28218210-28218232 AAGGAGAGTGCAGCAACTGCAGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116489938 14:45493316-45493338 AGGGAAAGCACAGCAATTTGAGG - Intergenic
1116504906 14:45665908-45665930 AGGAAGAACACAGCAATTGTGGG - Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117836700 14:59815467-59815489 AGAGAGACCATGGCAACTGTAGG - Intronic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118616514 14:67577881-67577903 AGAGGGAGCACTGCTACTGTTGG - Intronic
1118956532 14:70488219-70488241 AGAGAGAGCACAACAATTGGAGG + Intergenic
1120697322 14:87659044-87659066 AGGGAGAGCACGGTCACTGGAGG + Intergenic
1122195906 14:100085693-100085715 AGAGAGAGAACAGAAACTCTGGG + Intronic
1123216312 14:106812722-106812744 ATGGAGAACACTGCAGCTGTGGG + Intergenic
1123475813 15:20592153-20592175 AGGGAGAGCTCTGCACCTGCAGG - Intergenic
1123642198 15:22408210-22408232 AGGGAGAGCTCTGCACCTGCAGG + Intergenic
1125266921 15:37892268-37892290 AGGAAGAGGACAGTAACTGTTGG - Intergenic
1125429703 15:39581993-39582015 AGGGAGAGGACAGCACGTGAGGG - Intronic
1125920124 15:43520419-43520441 AAGGAGAGGACAGCCAGTGTGGG + Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1129030751 15:72616017-72616039 AGGGAGAATGCAGCAACTGTGGG - Intergenic
1129235616 15:74222119-74222141 GGGGAGACCACAACAGCTGTGGG + Intergenic
1129247717 15:74289925-74289947 AGGGAGAGCAGAGCAAGGGAAGG - Intronic
1129477594 15:75796541-75796563 AGGGAGAATACAGCAACTGTGGG - Intergenic
1129835661 15:78703818-78703840 AGGGAGAATGCAGCAACTGTGGG - Intronic
1130062206 15:80578175-80578197 AGGGAGAGCACAGCAGCAGGAGG + Intronic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1130878131 15:88032038-88032060 AGAGAGAGCACAGCAGCTCCTGG - Intronic
1136071202 16:27788349-27788371 AGGAAGATCACCGCAACTATGGG - Exonic
1136679124 16:31945057-31945079 AGGGAGATTGCAGCAACTGGGGG + Intergenic
1137273517 16:46918528-46918550 AGGGAGGGCACAGGTGCTGTGGG - Intronic
1138336768 16:56259569-56259591 AGGGAGAGCTCTGACACTGTCGG - Intronic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1139239399 16:65375469-65375491 TGGGTGAGCACAGCTAGTGTTGG - Intergenic
1140456848 16:75110777-75110799 AGGGAGAGCGCAGCTGCTGCAGG + Exonic
1140534389 16:75696119-75696141 AAGGAGAACACAGAAGCTGTTGG + Intronic
1142067569 16:88071571-88071593 AGGGAGAGCAAAGGAGCTGCTGG - Intronic
1143030747 17:3965604-3965626 AGGAAGAGCACAGAATCTGGGGG - Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145933790 17:28703486-28703508 AGGGAGAGAACAGCAGCAGAGGG + Exonic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1147210058 17:38867854-38867876 AGGGAGAGAACAGCAACCAGAGG + Intergenic
1147907812 17:43833967-43833989 GGGGAGAGCATAGGAACTGCTGG + Intergenic
1148328981 17:46801775-46801797 AGGGAGGGCAGTGCCACTGTGGG + Intronic
1149092919 17:52805211-52805233 AGGGAGCGCACAACAACTGAAGG - Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1150138850 17:62712063-62712085 AGAGTGAGCACAGCCACTCTTGG - Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150764475 17:67992828-67992850 AGGGTGAGAACAGCAAGGGTTGG - Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151158115 17:72141643-72141665 AGTGTCAGCAGAGCAACTGTGGG - Intergenic
1151850190 17:76685415-76685437 AGGCAGAGCACTGCAGATGTTGG - Intronic
1152273478 17:79339702-79339724 CGGGCTGGCACAGCAACTGTTGG + Intronic
1152452208 17:80388795-80388817 AGGGAGGCCGCAGAAACTGTGGG - Intronic
1152901188 17:82941948-82941970 AGAGACAGCACAGCAACCCTGGG - Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1153904430 18:9648666-9648688 AGTAAGAGCTCAGCAAATGTTGG - Intergenic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1159280583 18:66279636-66279658 AGACAGAGCACAGAACCTGTTGG + Intergenic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1160196008 18:76756002-76756024 GGGGAGAGCACTGCACATGTGGG + Intergenic
1164572593 19:29385179-29385201 AGGGTGAACACAGGAACTGGAGG + Intergenic
1166749596 19:45158652-45158674 AGGGTGAGCACCGGAGCTGTAGG + Exonic
1167784744 19:51627720-51627742 AGGAGGGGCCCAGCAACTGTGGG + Exonic
1167852513 19:52212930-52212952 AGGGAGAGGAGAGGAACAGTGGG - Intronic
925115313 2:1373744-1373766 AGGGAGAGCGGAGAGACTGTGGG - Intergenic
925747365 2:7055008-7055030 AGGAAGAGTAAAGCAACTGCAGG - Intronic
926299276 2:11590472-11590494 AGGGAAGGAACAGCAAGTGTGGG - Intronic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927196625 2:20552144-20552166 AGGCAGAGCCCAGCAAGGGTGGG - Intergenic
927277047 2:21271235-21271257 TGGGATTGCACAGCAACTTTGGG + Intergenic
927851378 2:26502101-26502123 AAGCAGAGCACAGCAGCTGCAGG - Intronic
927942182 2:27111683-27111705 AAGTAGAGCACAGCAGCTGCTGG + Intronic
928131978 2:28658488-28658510 GGAGAGAGAACAGCAAATGTGGG + Intergenic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928726328 2:34178034-34178056 AAGGAGACCACAGCTATTGTGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930317554 2:49816229-49816251 GGGGAGAACAAAGCAACAGTGGG + Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930897669 2:56464345-56464367 AGGCTGTGCACTGCAACTGTGGG - Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
931685126 2:64785899-64785921 AGGGAGACCACAGCAGCTTCTGG + Intergenic
932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG + Intronic
934652275 2:96099458-96099480 AGAGAGAGGACTGCATCTGTGGG - Intergenic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
936641539 2:114317355-114317377 AAGGAGAGCTCAGCGACTGGGGG - Intergenic
937628242 2:124068286-124068308 AGACAGAGCGCAGCAACTGGTGG + Intronic
940012966 2:149073859-149073881 AGGGAGAGGACAGCAACCTCGGG + Intronic
940461489 2:153968382-153968404 AGGGACAGCAAAGGAAGTGTGGG - Intronic
940469403 2:154076087-154076109 AGGGAGAGCAGAGCTGCTGTTGG - Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941528352 2:166633025-166633047 AGGGAGAGCCCAGCAATTCTGGG - Intergenic
941595579 2:167472712-167472734 AGGAAGAGCACAGCAAGCGGAGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
941888901 2:170557724-170557746 GGGGTGAGCACAGGAGCTGTGGG + Intronic
942294761 2:174506952-174506974 AGAGAAAGCACAGCGAGTGTCGG + Intergenic
942391893 2:175503362-175503384 AGGGACAGCATAGCAATTGGTGG - Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943557355 2:189421788-189421810 AGGCAGACCTCAGCAGCTGTGGG + Intergenic
944046046 2:195413426-195413448 AGGAAGAGCACAGCAATCGTGGG + Intergenic
944126977 2:196305170-196305192 ACAGAGATGACAGCAACTGTGGG - Intronic
944238136 2:197459132-197459154 AAGGAGAACGCAGCAACAGTTGG + Intronic
945529116 2:210927685-210927707 AGTGAGAGCACAGCACGTGCAGG - Intergenic
946196302 2:218034600-218034622 AGGCAGAGCACAGCCAGGGTGGG + Intergenic
946510366 2:220349344-220349366 ATGGAGAGAACAACATCTGTGGG + Intergenic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948319196 2:237056108-237056130 CCTGGGAGCACAGCAACTGTTGG + Intergenic
948477260 2:238227983-238228005 AGGGAAAGCCCAGCAAAAGTGGG + Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948892671 2:240915016-240915038 AGGGAGGGCGCAGGGACTGTAGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168831107 20:845666-845688 CGGGAGAGCCCAGCAGCTGAAGG + Exonic
1169782889 20:9328125-9328147 AGGGAGAGTACATCAAATGAGGG + Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171009891 20:21503467-21503489 AGGGAGTGCACAGGGGCTGTGGG + Intergenic
1171037187 20:21724523-21724545 AGGGAGAGAAGAGCCACTGAAGG - Intergenic
1171209776 20:23308390-23308412 AAGGAGATCACTCCAACTGTGGG - Intergenic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1174371149 20:50088982-50089004 ATGCAGATCACAGTAACTGTTGG + Intronic
1174451587 20:50624175-50624197 AGAGGGAGCACAGCCCCTGTGGG - Intronic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1177212768 21:18091042-18091064 AGGGAAAGCACAGCACCTGGGGG + Intronic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1178421185 21:32444682-32444704 AGGGAGAGGAGAGGAACTGAAGG - Intronic
1178572314 21:33750247-33750269 AGGGGGGGCACAGCTGCTGTGGG - Exonic
1179028089 21:37697076-37697098 ATGAAGACCACAGCACCTGTTGG - Intronic
1179423532 21:41254794-41254816 AGAGAGAAGACAGCATCTGTGGG - Intronic
1180137467 21:45871003-45871025 AGGGAGAGCCCAGCACCCGCTGG + Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180741152 22:18054043-18054065 AGGCAGTGCACACAAACTGTGGG - Intergenic
1180835515 22:18927643-18927665 AGGATGAACACAGCAGCTGTGGG - Intronic
1181116751 22:20636315-20636337 AGCGATAGCACAGCACATGTGGG + Intergenic
1182080311 22:27524235-27524257 AGGGAGAGCACAGCTTCCCTAGG + Intergenic
1182728272 22:32466439-32466461 AGGTAGAGCAATGCAACTGGGGG + Intergenic
1183393438 22:37559052-37559074 AGGGACAGCACAGCAAAGGCTGG - Intergenic
1184421577 22:44385461-44385483 AGGGGGAGTGCAGCCACTGTGGG - Intergenic
1203285603 22_KI270734v1_random:152942-152964 AGGATGAACACAGCAGCTGTGGG - Intergenic
950801197 3:15552974-15552996 AGGGAGAGTGCCGTAACTGTGGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
951495166 3:23317388-23317410 ACGGAGAGCACACCAACTGTGGG - Intronic
951548946 3:23857709-23857731 AGGCAGAGCACAACAGCTCTTGG - Intronic
952066559 3:29577719-29577741 AGGGAGAATACAGCAACTGGGGG - Intronic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
953804613 3:46057371-46057393 AAGGGGCGCAAAGCAACTGTTGG + Intergenic
953988327 3:47463109-47463131 TGGGAAAGAACAGCTACTGTGGG - Intronic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957050202 3:75405857-75405879 AGGGAGAGGAGAGGAACTGAAGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
959111891 3:102132515-102132537 ATGGAGTTCACAGCAGCTGTGGG - Intronic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959409150 3:105998399-105998421 AGGGACAGCACAGCAACTCTGGG - Intergenic
959716769 3:109442442-109442464 AGGGAGACTGCAGCAATTGTGGG + Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960840933 3:121957918-121957940 AGGGAAAGCACCGTAATTGTGGG + Intergenic
960862915 3:122169500-122169522 AGGGAGAGTGCAGCAATTATGGG - Intergenic
961882517 3:130072294-130072316 AGGGAGAGGAGAGGAACTGAAGG + Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963292161 3:143503213-143503235 AGGGACTGCACAGCAGCTGAGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964432078 3:156617817-156617839 GGGCAGAGCACAGGAATTGTTGG + Intergenic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965322379 3:167265893-167265915 AGGGAGAGCACATCAACTAGAGG - Intronic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965735184 3:171811517-171811539 AAGGAGGGCTGAGCAACTGTAGG - Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
966437474 3:179904848-179904870 AGGGACAGCACAGCAGCAGTAGG - Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968017908 3:195356193-195356215 GGAAAGAGCACAGCAACTGTGGG + Intronic
968247371 3:197165990-197166012 AGGGTGAGGAAAGCATCTGTAGG + Intronic
968500294 4:946818-946840 AGGGAGAGCGCGGCCCCTGTAGG + Intronic
968500322 4:946939-946961 AGGGAGAGCACGGCCCCTGTAGG + Intronic
968500336 4:947000-947022 AGGGAGAGCGCGGCCCCTGTAGG + Intronic
968500366 4:947126-947148 GGGGAGAGCGCAGCCCCTGTAGG + Intronic
969149273 4:5154845-5154867 GGGAAGAGGACAGCAACTCTTGG + Intronic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973169468 4:47121265-47121287 AAGAAAAGCACAGCAATTGTGGG - Intronic
973207999 4:47582184-47582206 AGGGTGATCACAGCTACTCTGGG + Intronic
973218329 4:47697193-47697215 GGGGAGAGCACTGTATCTGTAGG + Intronic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973634604 4:52850395-52850417 AGTCAGAGCACAGAAACTTTAGG - Intergenic
973763206 4:54139672-54139694 AGGGAGAGCACAGCAACCGGGGG + Intronic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
976030147 4:80741995-80742017 ATGGAGAGCACAGCAAATGGGGG - Intronic
976062121 4:81140543-81140565 ATGGAGAGCACAGCTCCTCTAGG + Exonic
976082940 4:81376033-81376055 GGGGAGGGCACAGCGATTGTGGG - Intergenic
976523468 4:86058328-86058350 AGGGGGAGGACAGCATCTGTGGG - Intronic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
977381120 4:96274851-96274873 AGAGAGACCACAGCAACTGTGGG - Intergenic
977521740 4:98093745-98093767 AGGCAAAGCACAGCAATTGGGGG + Intronic
978096419 4:104784456-104784478 AGAGAAAGCACAGAGACTGTGGG - Intergenic
978437034 4:108696683-108696705 AGAGATAGGACAACAACTGTTGG + Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979067607 4:116157862-116157884 TGGGAGAACACAGAAACTGAAGG - Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
980105979 4:128588911-128588933 AGGGTGGGCACAGCACCTCTGGG - Intergenic
980115222 4:128672808-128672830 AGGTTGAGCACAGCAGCTGCTGG - Intergenic
980442487 4:132867115-132867137 AGGGAGAACACAGCAACTGGAGG + Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
981629321 4:146800187-146800209 AGAGGGAACACAGCAAATGTAGG - Intronic
981996046 4:150976809-150976831 TGGGAGAGTGCAGCGACTGTGGG + Intronic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982899626 4:160981601-160981623 AGGCAGAGCACAGAGACTGGGGG - Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
984871318 4:184327761-184327783 AGGAAGAACACAGCAAATGCTGG + Intergenic
985830960 5:2229497-2229519 AGGCAGAGGACAGCAAGTCTTGG - Intergenic
985942593 5:3150604-3150626 AGGGAGAGGAGAGGAGCTGTGGG + Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
989672498 5:43935505-43935527 AGGGAAAGAACAGCAATTGTGGG + Intergenic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991254940 5:64603336-64603358 AGGCAGAGAACAACAACTTTTGG + Intronic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
992257263 5:74933441-74933463 AGGGAGAGCACAGGAAATCGGGG + Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994005472 5:94832105-94832127 AAGGATACCACAGAAACTGTAGG - Intronic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
995557426 5:113344123-113344145 AGGGAAAGCACAGCAAGTGGGGG + Intronic
995836344 5:116403258-116403280 AGTGAAAGCACAGCAATGGTGGG - Intronic
997607503 5:135185639-135185661 AGGCAGAGCCCAGCAGCTGTGGG + Intronic
998498517 5:142611928-142611950 AGGAACAGCACAGCACGTGTTGG - Intronic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
1001200420 5:169711053-169711075 AGGCAGAGCAAAGGAACTGAGGG - Intronic
1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1002094855 5:176824740-176824762 AGGGAGTGCACAGGCACTGGGGG - Intronic
1002570164 5:180135679-180135701 TGGGAGAGCAAAGCAGGTGTGGG + Intronic
1004142078 6:13027459-13027481 AGGAAGAGCACAGCTTCTGCTGG - Intronic
1006979704 6:38137175-38137197 AGAGTGAGCTCAGCAAGTGTAGG + Intronic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008230901 6:48984090-48984112 AAGTGGAGCACAGCAACTGCTGG - Intergenic
1008567836 6:52786661-52786683 AAGTTGAGCACAGCAGCTGTTGG - Intergenic
1008707661 6:54182318-54182340 AGGAAGAGCACAGCAACTGGGGG - Intronic
1008775769 6:55035745-55035767 AGGGAGAGCAGAGGAATTTTTGG - Intergenic
1008940396 6:57040183-57040205 AGGGAAAGCACAGCAACTGGAGG + Intergenic
1009664319 6:66655580-66655602 AAGTTGAGCACAGCAGCTGTGGG + Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1011340892 6:86313219-86313241 AGGGAGACCACAGCAATTGTAGG + Intergenic
1011359814 6:86511371-86511393 AGGGGGAGAACAGTAATTGTGGG - Intergenic
1011791965 6:90908026-90908048 AAAAAGAGCACAGCAACTGAGGG - Intergenic
1012783124 6:103589062-103589084 AGGGAAAGCGCAGCAATAGTGGG - Intergenic
1012807207 6:103909168-103909190 AAAGAGAGCACAGCAACTGAAGG - Intergenic
1013466220 6:110419194-110419216 ATGGAGAGCACAGCAAGAGGGGG - Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014430536 6:121365379-121365401 GGAGAGAGCACAGCAATTGTGGG + Intergenic
1014794606 6:125710324-125710346 AGGGAGAACGCAGGAATTGTGGG + Intergenic
1014840902 6:126219007-126219029 AGGGAAAGCATAACAATTGTGGG - Intergenic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017259340 6:152369055-152369077 AGAGAAAGCTCAGCAGCTGTGGG - Exonic
1017924847 6:158901826-158901848 AGGGAGAGCACAGCAACTAGGGG - Intronic
1018468798 6:164078858-164078880 AGAGAGTACTCAGCAACTGTGGG - Intergenic
1018732627 6:166663759-166663781 AGGATGAACACAGCAACTGCTGG + Intronic
1018835094 6:167477133-167477155 GGGGAGAACACAGCCACTGAAGG + Intergenic
1020624195 7:10557901-10557923 AGGGAAAGCACAGCAACTGGGGG + Intergenic
1020807009 7:12802405-12802427 AAGGAGAGCACAGCAGCCCTAGG - Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021640864 7:22735055-22735077 AAGGAGAACACATCAATTGTGGG + Intergenic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023085260 7:36564029-36564051 AGGCAGATCACAGCTACTGTGGG - Intronic
1024339139 7:48239399-48239421 AGAGAGGGGACAGCACCTGTTGG - Exonic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024700099 7:51897599-51897621 AGAGAGAGCAAAGTAATTGTCGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1026165485 7:67905560-67905582 AGGGAGAGCACTGCTTCTGCTGG - Intergenic
1027278104 7:76583265-76583287 AGGGAGATCACTGCAAGTGAAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031199441 7:118661090-118661112 AGAAAGGGCACTGCAACTGTGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031746638 7:125506473-125506495 AGGGAGAACACAGCAACTGGAGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032939028 7:136767577-136767599 AGAGAGAGCACAGCAACTGGGGG + Intergenic
1033536832 7:142320456-142320478 AGGAAAAGCAAAGGAACTGTGGG + Intergenic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1035138980 7:156738175-156738197 AGGGAGAGCACAACAAATGGGGG + Intronic
1035300739 7:157895915-157895937 AGGGTGAGCACAGAGACTGCAGG + Intronic
1035705362 8:1670564-1670586 AGGGAGTGCTCAGTAAATGTTGG + Intronic
1036814934 8:11895015-11895037 AAGGAGAGCACAGCAATCGCGGG - Intergenic
1038863039 8:31408577-31408599 AGGAACTGCACAGCAACTGTGGG - Intergenic
1039846986 8:41332473-41332495 AGGAAGAACATAGCCACTGTGGG - Intergenic
1040049769 8:43001916-43001938 AGGGAGAGCACAGCCCCTAAGGG - Intronic
1040295980 8:46149304-46149326 GGGGAGATCACAGGAAATGTTGG - Intergenic
1040721103 8:50324270-50324292 AGGAAGAGCACAGCAACTGAGGG - Intronic
1041456718 8:58068384-58068406 AGGGAAAGCACAGAAACTCATGG - Intronic
1041462052 8:58121863-58121885 AGTCACAGCACAGCAGCTGTTGG - Intronic
1041464180 8:58142526-58142548 TGGGGGAGCACATCATCTGTGGG - Intronic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1041582960 8:59483845-59483867 AGAGAGAGCATAGCAACTGGGGG - Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1044124165 8:88437342-88437364 AGGGAGAGCCCAGCGATTCTGGG + Intergenic
1044616212 8:94144993-94145015 AGGCTGAGCACAGCAAGTGCTGG + Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052056666 9:23914629-23914651 AAGTAGAGCACAGCAGCTGCTGG + Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052258900 9:26491793-26491815 AGGGAGAACACAGCAGTTGTGGG - Intergenic
1053288784 9:36866524-36866546 AGGAAGAGCACAACAAAAGTTGG + Intronic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055220204 9:73920062-73920084 AGGGAAAGCACAGCAAATACAGG - Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056578078 9:87870877-87870899 AGGGAGAGCAGAGCAGCCGCAGG + Intergenic
1056581457 9:87890081-87890103 AGGGAGAGCTCTGCACCTGCAGG + Intergenic
1057624870 9:96668059-96668081 AGGTAGAGCACAGGAACAGTGGG + Intergenic
1057644316 9:96858874-96858896 AGGGAGAGCACAGCAGCTGTGGG + Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060328587 9:122643303-122643325 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1061164887 9:128916520-128916542 AGCGAGAGGACAGTATCTGTGGG + Exonic
1061481621 9:130900284-130900306 AGGGCCAGCACAGCGACTGGTGG - Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1062181218 9:135192242-135192264 AGTGGGAGCACAGCAGCTGAGGG - Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185463366 X:342433-342455 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463374 X:342460-342482 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463465 X:342784-342806 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463473 X:342811-342833 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463481 X:342838-342860 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463489 X:342865-342887 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463497 X:342892-342914 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463793 X:343919-343941 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463801 X:343946-343968 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463809 X:343973-343995 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185463856 X:344135-344157 AGGGAGACCTCAGCAACGGGAGG + Intronic
1185832988 X:3319314-3319336 AGGCAAAGGACAGCAAATGTGGG + Intronic
1185842632 X:3407055-3407077 AGACTGAGCATAGCAACTGTTGG + Intergenic
1186326864 X:8487675-8487697 AGATAGAGCAAAGCCACTGTGGG - Intergenic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1187364088 X:18652133-18652155 AGAGAGTGCCCAGCACCTGTGGG - Intronic
1187575125 X:20545995-20546017 AGGGACAGCACAGCAATTGTGGG - Intergenic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1188421225 X:29992518-29992540 AGGGAGGGCATAGTAATTGTGGG - Intergenic
1188625199 X:32276065-32276087 AGGGACAGTACAGCTACTGGGGG + Intronic
1188715521 X:33455711-33455733 AGGGAGAGTGCAGCAATTCTGGG + Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1188973266 X:36642555-36642577 AGGAAAAGCAAAGCAACTGTGGG - Intergenic
1188974775 X:36659978-36660000 AAGGAGAGCACAGAGACTGGGGG + Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189884959 X:45533123-45533145 GGGGAGAGTACAGCAATTGGAGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190374467 X:49775451-49775473 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1190537135 X:51440588-51440610 AGGGACAGCACAGCAACTGGGGG + Intergenic
1190797382 X:53758251-53758273 AGTGAGCGCACAGCAAGTGCAGG - Intergenic
1190913187 X:54790431-54790453 AGTGAGTGCACAGCAAGTGCAGG - Intronic
1191194228 X:57704204-57704226 AGGGAGAGTAAGGCTACTGTGGG - Intergenic
1191586876 X:62837073-62837095 AGGCAGAGAATAGCAAGTGTTGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1193015910 X:76733615-76733637 AGGGAGTCCAAGGCAACTGTAGG - Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193650158 X:84122235-84122257 AGGGAAAGCTCAGCAACTGGGGG + Intronic
1193802349 X:85951912-85951934 AGTGAGAGCATAGCAACTGGGGG + Intronic
1193912137 X:87318258-87318280 AGCGAAAGAACAGCAATTGTGGG - Intergenic
1193933198 X:87582386-87582408 AGGGATAACACAGCAATTGTGGG + Intronic
1194095647 X:89636024-89636046 AGGGACAGCACAGCAATTGTGGG + Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194882685 X:99273459-99273481 AGGGAGAATACAGCAACTGGAGG + Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195199244 X:102532133-102532155 AGGAAGAGTGCAGCAACTGGGGG + Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195543435 X:106088249-106088271 AAGGAAAGCACAGCAATTGTGGG - Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196182245 X:112704660-112704682 AGGGAGAGCACAGGAACTGAAGG - Intergenic
1196215746 X:113050049-113050071 AGGGAGAATGCAGCAATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196485704 X:116204163-116204185 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1196510217 X:116500280-116500302 AGAGAGAGCACTGCAACTGGGGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1197053802 X:122093477-122093499 GGGAAGAGCACAGCGATTGTGGG + Intergenic
1197072826 X:122321355-122321377 AAGGAGAGCACAGCAACTGGGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197435761 X:126425959-126425981 AGGGAGAAAACAGCAATTATGGG - Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197953034 X:131918400-131918422 AGGGAGAGTGCAGCAACTGTGGG + Intergenic
1198278062 X:135116200-135116222 AGGGAGAGTGCAGCAAGTGGGGG - Intergenic
1198292900 X:135256316-135256338 AGGGAGAGTGCAGCAAGTGGGGG + Intronic
1198724785 X:139665474-139665496 AGGGAGATCACAGAAACTGTGGG - Intronic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1199138997 X:144287957-144287979 AGGGAGAGCACAGCAAGTGAGGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG + Intergenic
1200370089 X:155715867-155715889 AGGGCAAGCACAGCGACTGGGGG - Intergenic
1200448646 Y:3297392-3297414 AGGGACAGCACAGCAATTGTGGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic
1201730097 Y:17193348-17193370 GGGGAAGGCACAGCAGCTGTAGG + Intergenic