ID: 1021845245

View in Genome Browser
Species Human (GRCh38)
Location 7:24757281-24757303
Sequence GAGAAAGCGCCGCGCGGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 67}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021845236_1021845245 11 Left 1021845236 7:24757247-24757269 CCCCTAGGAAGGAGCGAGGGGAG 0: 1
1: 0
2: 1
3: 31
4: 227
Right 1021845245 7:24757281-24757303 GAGAAAGCGCCGCGCGGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 67
1021845239_1021845245 9 Left 1021845239 7:24757249-24757271 CCTAGGAAGGAGCGAGGGGAGGG 0: 1
1: 0
2: 6
3: 72
4: 522
Right 1021845245 7:24757281-24757303 GAGAAAGCGCCGCGCGGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 67
1021845230_1021845245 26 Left 1021845230 7:24757232-24757254 CCAATCGATTCGTCTCCCCTAGG No data
Right 1021845245 7:24757281-24757303 GAGAAAGCGCCGCGCGGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 67
1021845237_1021845245 10 Left 1021845237 7:24757248-24757270 CCCTAGGAAGGAGCGAGGGGAGG No data
Right 1021845245 7:24757281-24757303 GAGAAAGCGCCGCGCGGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021845245 Original CRISPR GAGAAAGCGCCGCGCGGCCT CGG Intronic