ID: 1021845338

View in Genome Browser
Species Human (GRCh38)
Location 7:24757558-24757580
Sequence GGCCGCCGGAGGCTGCGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 381}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021845329_1021845338 -5 Left 1021845329 7:24757540-24757562 CCCCAGAGCCGCGGGACTGGCCG 0: 1
1: 0
2: 0
3: 7
4: 282
Right 1021845338 7:24757558-24757580 GGCCGCCGGAGGCTGCGGGAGGG 0: 1
1: 0
2: 4
3: 34
4: 381
1021845327_1021845338 2 Left 1021845327 7:24757533-24757555 CCGGGCGCCCCAGAGCCGCGGGA 0: 1
1: 0
2: 0
3: 13
4: 205
Right 1021845338 7:24757558-24757580 GGCCGCCGGAGGCTGCGGGAGGG 0: 1
1: 0
2: 4
3: 34
4: 381
1021845316_1021845338 28 Left 1021845316 7:24757507-24757529 CCCGCCCGCCGGGACCTTTGCTC 0: 1
1: 0
2: 0
3: 14
4: 101
Right 1021845338 7:24757558-24757580 GGCCGCCGGAGGCTGCGGGAGGG 0: 1
1: 0
2: 4
3: 34
4: 381
1021845331_1021845338 -7 Left 1021845331 7:24757542-24757564 CCAGAGCCGCGGGACTGGCCGCC 0: 1
1: 0
2: 1
3: 7
4: 120
Right 1021845338 7:24757558-24757580 GGCCGCCGGAGGCTGCGGGAGGG 0: 1
1: 0
2: 4
3: 34
4: 381
1021845319_1021845338 24 Left 1021845319 7:24757511-24757533 CCCGCCGGGACCTTTGCTCGGTC 0: 1
1: 0
2: 1
3: 4
4: 56
Right 1021845338 7:24757558-24757580 GGCCGCCGGAGGCTGCGGGAGGG 0: 1
1: 0
2: 4
3: 34
4: 381
1021845322_1021845338 20 Left 1021845322 7:24757515-24757537 CCGGGACCTTTGCTCGGTCCGGG 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1021845338 7:24757558-24757580 GGCCGCCGGAGGCTGCGGGAGGG 0: 1
1: 0
2: 4
3: 34
4: 381
1021845330_1021845338 -6 Left 1021845330 7:24757541-24757563 CCCAGAGCCGCGGGACTGGCCGC 0: 1
1: 0
2: 0
3: 3
4: 325
Right 1021845338 7:24757558-24757580 GGCCGCCGGAGGCTGCGGGAGGG 0: 1
1: 0
2: 4
3: 34
4: 381
1021845324_1021845338 14 Left 1021845324 7:24757521-24757543 CCTTTGCTCGGTCCGGGCGCCCC 0: 1
1: 0
2: 0
3: 11
4: 172
Right 1021845338 7:24757558-24757580 GGCCGCCGGAGGCTGCGGGAGGG 0: 1
1: 0
2: 4
3: 34
4: 381
1021845317_1021845338 27 Left 1021845317 7:24757508-24757530 CCGCCCGCCGGGACCTTTGCTCG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1021845338 7:24757558-24757580 GGCCGCCGGAGGCTGCGGGAGGG 0: 1
1: 0
2: 4
3: 34
4: 381
1021845320_1021845338 23 Left 1021845320 7:24757512-24757534 CCGCCGGGACCTTTGCTCGGTCC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1021845338 7:24757558-24757580 GGCCGCCGGAGGCTGCGGGAGGG 0: 1
1: 0
2: 4
3: 34
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021845338 Original CRISPR GGCCGCCGGAGGCTGCGGGA GGG Intronic
900087399 1:904988-905010 GGGTGCCGGGGGGTGCGGGAAGG + Intergenic
900369671 1:2326021-2326043 GGCGGGAGGAGGCCGCGGGAGGG - Intronic
900414661 1:2529476-2529498 GGCCGCCAGAGGCCGCAGGCGGG + Exonic
900481814 1:2902996-2903018 GGCCACCGGAGGCCCAGGGAGGG - Intergenic
900604382 1:3517250-3517272 GGGCCCAGGAGGCTGCGGCAGGG + Intronic
900611338 1:3545813-3545835 GCCAGCGGGAGGCTGGGGGAGGG - Intronic
900923828 1:5690731-5690753 GGCTCCCGGAGGCTGAGAGAGGG + Intergenic
900933299 1:5750288-5750310 GTCAGCCGCAGGCTGCGGGTGGG - Intergenic
901045448 1:6393223-6393245 GGCCGCTGCAGGCTGCGCGCGGG + Intronic
901204021 1:7483750-7483772 GTCAGCAGGAGGCTGCAGGAAGG - Intronic
901521418 1:9787906-9787928 GGCTGCCAGGGGCTGGGGGAGGG - Intronic
902057020 1:13609593-13609615 GGCTGCCAGGGGCTGGGGGAAGG - Intronic
902549452 1:17210742-17210764 GGCTGCTGGAGGTTGAGGGAGGG - Intronic
902616584 1:17626770-17626792 GGTTGCCGGAGGCTGTGGGGAGG - Intronic
903077843 1:20786378-20786400 GCCCGCAGAAGGCCGCGGGAAGG + Intronic
903305642 1:22411133-22411155 GGCGGCCGGGGGCTGAGGGGAGG - Intergenic
904162281 1:28530704-28530726 GGCTGCCCGGGGCTGCGGGTTGG + Intronic
905873209 1:41416559-41416581 GGCCGCAGGAGGCAGAGGAAGGG - Intergenic
905912233 1:41662629-41662651 GGCTGCCGGCGGCCGCGGGGAGG + Intronic
908021903 1:59906647-59906669 GGTGGCCAGAGGCTGAGGGAGGG - Intronic
912302022 1:108527894-108527916 GGCTGCCAGGGGCTGAGGGAGGG - Intergenic
912722059 1:112028582-112028604 GGCAGCAGGGGGCTGCTGGAGGG - Intergenic
912993276 1:114510326-114510348 GGCTGCGAGAGGCTGGGGGAGGG - Intronic
913182331 1:116334204-116334226 GGCAGCTGGAGGCAGCTGGATGG - Intergenic
914824902 1:151133210-151133232 GCCCTCCGGAGGCGGCAGGAAGG + Exonic
915534253 1:156525299-156525321 GGCTGGGGGAGGCTGCAGGAAGG + Intergenic
921472712 1:215567675-215567697 AGCCGCCGGAGATGGCGGGAGGG + Exonic
922472733 1:225886919-225886941 GGCCTCCGGGGGCTGCCGGCAGG + Exonic
922480547 1:225937633-225937655 GGCCTCCGGGGGCTGCTGGCAGG + Exonic
922811155 1:228416420-228416442 GGCGGCCGGCGGAGGCGGGAAGG + Intronic
923011260 1:230089576-230089598 GGCCGCCAGTGGCTGCAGGGAGG - Intronic
923217790 1:231865613-231865635 GGTTGCCAGAGGCTGGGGGAAGG - Intronic
923519242 1:234723193-234723215 GGGCGCCCGAGCCTGCGGGTGGG - Intergenic
923674841 1:236071459-236071481 GGTCGCCAGAGGCTGAGGGAGGG - Intergenic
924005304 1:239603020-239603042 GGTTGCCAGAGGCTGGGGGAAGG - Intronic
924626437 1:245699773-245699795 GCCTGCCGGAGGCTGAGGGCTGG - Intronic
1063011931 10:2030869-2030891 GGTTGCCTGAGGCTGAGGGAGGG - Intergenic
1063387468 10:5625050-5625072 GGCCGCCGGAGGGTGGCTGACGG - Intergenic
1064354403 10:14604324-14604346 GGCGGCCCGAGGCGGCGCGAGGG + Intronic
1067416427 10:46106491-46106513 GGGCGCCGGCGCCTGCGGGAGGG - Intergenic
1067436558 10:46282969-46282991 GGGCGCCGGCGCCTGCGGGAGGG - Intergenic
1068955255 10:62815278-62815300 GGCCGGCGGAGGCAGCGAGTGGG - Intronic
1071131666 10:82400812-82400834 GGCAGCCTGAGGCAGCAGGATGG - Intronic
1072177358 10:92941091-92941113 GGTTGCCAGAGGCTGGGGGAAGG - Intronic
1073366453 10:102946226-102946248 GGAGGCCAGAGGCTGGGGGAGGG + Intronic
1075587132 10:123666245-123666267 GGCCGCCTGAGGCTCCGGGGTGG + Intergenic
1075661486 10:124200011-124200033 GGCCGACTCAGGCTGCTGGAGGG - Intergenic
1075678372 10:124313784-124313806 GGGCGCTGGAGGCTGCTGCATGG - Intergenic
1076103039 10:127797848-127797870 GATGGACGGAGGCTGCGGGATGG - Intergenic
1076401976 10:130190622-130190644 GGCAGCCGCAGGCAGCGGGGCGG - Intergenic
1076707211 10:132308347-132308369 GGCCCCCGGAGACCGCGAGAAGG - Intronic
1076800402 10:132820331-132820353 GGCTGACGGGGGCTGGGGGAGGG + Intronic
1076981862 11:208945-208967 GGCCGCCTGAGGCCGGGGGGCGG + Intronic
1076993893 11:289257-289279 GGCGGCCGGGAGCTGCGGGGCGG - Intronic
1077038362 11:506481-506503 TGCCGCCTGGGGCTGCGGGGAGG - Intronic
1077140739 11:1023788-1023810 GGCAGCTGGGGGCTGCGGGAGGG + Intronic
1077474454 11:2779760-2779782 GGCCCCAGCAGGCTGCTGGACGG - Intronic
1077920914 11:6641167-6641189 GGCAGCCCGAGCCTGTGGGAAGG + Exonic
1081671153 11:44943364-44943386 GGCTGCAGGAGGCTGGGGGCAGG + Intronic
1081672819 11:44950976-44950998 GGCCGCCGGGGCGGGCGGGATGG + Intronic
1081831608 11:46120392-46120414 GCCGGCCGGGGGCTGCGGGCGGG - Intronic
1081967219 11:47177187-47177209 GGCTGCGGGAGGCTGGGGGCGGG + Intergenic
1082784949 11:57311617-57311639 GGCCTCTGGGGGCTGCGGGGCGG - Intronic
1083578993 11:63813290-63813312 GGACCCGGGAGGCGGCGGGAAGG - Intergenic
1083883250 11:65558501-65558523 GGCTGGCGGAGGCTGGGGGGTGG + Intronic
1085409736 11:76284027-76284049 GGCCGCAGCAGCCTGTGGGATGG - Intergenic
1086087905 11:82974076-82974098 GGTTGCCGGATGCTGGGGGAAGG + Exonic
1087878931 11:103392207-103392229 GGCAGCAGGAGGCTGGGGGAGGG - Intronic
1088604157 11:111512643-111512665 AGGAGCGGGAGGCTGCGGGAAGG + Intergenic
1089492380 11:118892135-118892157 GGCAGAGGGATGCTGCGGGAAGG + Intronic
1090473503 11:127000383-127000405 GGGCGCGGGAGGCTGTGGGCAGG - Intronic
1091236357 11:134024879-134024901 GGCCTCTGTAGGCTGCTGGAAGG - Intergenic
1091531921 12:1366044-1366066 GACTGCCAGAGGCTGGGGGAGGG + Intronic
1091916177 12:4272967-4272989 GGCCGCCGCAGGCCGGGGGCAGG - Intergenic
1092401498 12:8182518-8182540 GTCCTCCAGAGGCTGCAGGAGGG + Intronic
1092659507 12:10723049-10723071 CTCCGTCGGAGCCTGCGGGAGGG + Exonic
1092814301 12:12299624-12299646 GGTTGCCGGGGGCTGAGGGAGGG - Intergenic
1094041081 12:26122486-26122508 GGCGGCCGCGGGCTGCGGGAAGG + Exonic
1094243861 12:28263360-28263382 AGTCGCCAGAGGCTGAGGGAAGG - Intronic
1095958304 12:47819056-47819078 GGGCGCCGCAGGCTGTGTGAGGG - Intronic
1095998061 12:48105999-48106021 GGCGGCGGGAAGCTGGGGGAGGG - Exonic
1096389592 12:51218097-51218119 AGCCGCCGGGGGCGGCGGGCTGG + Intergenic
1101813604 12:108129198-108129220 CTCCCCGGGAGGCTGCGGGAGGG + Intergenic
1102136853 12:110582896-110582918 GGCCGGCTGCGGCTTCGGGAAGG - Exonic
1103630915 12:122260105-122260127 GGCTGCCAGAGGCTGAGGGAAGG + Intronic
1103749685 12:123150600-123150622 GCCCGCCGGGGGCTGGAGGAGGG - Intergenic
1103833865 12:123803311-123803333 GGCCAGAGGAGGCTGCGGGCAGG + Intronic
1103889381 12:124227366-124227388 GTTCGCCAGAGGCTGGGGGAAGG + Intronic
1104006272 12:124894877-124894899 GGCTGCCAGAGGCTGGAGGAGGG - Intergenic
1104357199 12:128097709-128097731 GGTTGCCGGAGGCTGGGGGCAGG + Intergenic
1104376262 12:128267331-128267353 GGCCGGCGGGGGCCGCGGGCGGG + Intergenic
1104766694 12:131334279-131334301 TGCCTCTGGAGGATGCGGGATGG - Intergenic
1104859510 12:131917098-131917120 GGGGGTCGGAGGCTGTGGGATGG + Intronic
1104859518 12:131917119-131917141 GGGGGTCGGAGGCTGTGGGATGG + Intronic
1104859526 12:131917140-131917162 GGGGGTCGGAGGCTGTGGGATGG + Intronic
1104971831 12:132534235-132534257 GGCCTCCATGGGCTGCGGGAGGG + Intronic
1107007480 13:35630747-35630769 GGCCTCTGGGGGCTGGGGGAAGG - Intronic
1112216341 13:97434361-97434383 GGCAGCGGGAGGCGGCGGGGCGG + Exonic
1112298433 13:98209402-98209424 GGCAGACAGAGGCAGCGGGAGGG + Intronic
1113110296 13:106815640-106815662 GGCAGCCAGTGGCTGGGGGATGG - Intergenic
1113631816 13:111893464-111893486 GGCGCCCGGAGGCCGCTGGAGGG + Intergenic
1114491653 14:23106183-23106205 GGCCGGGGGAGGCGGGGGGAGGG - Intergenic
1117424628 14:55580865-55580887 GACCGCCGGAGGCAGCGGCGAGG - Intronic
1117927755 14:60802103-60802125 GGCTACCAGAGGCTGTGGGATGG + Intronic
1118313292 14:64708351-64708373 ACCTGCCGGAGGCTGGGGGAGGG - Intronic
1118809004 14:69260380-69260402 GGCCGCCGGAGGATGCTGCGTGG - Exonic
1119539236 14:75428025-75428047 GCCCGCCACAGCCTGCGGGAGGG + Intronic
1121253086 14:92513911-92513933 TGCCGCCGGCAGCTCCGGGACGG - Exonic
1121259170 14:92553699-92553721 GCCCCCCGGAGGATGTGGGAGGG + Intronic
1122354144 14:101113211-101113233 GCCCGCAGGAGGCTGAGGCACGG - Intergenic
1122414835 14:101544163-101544185 GCTCGCCGGGGGCTGGGGGAAGG + Intergenic
1122448941 14:101788075-101788097 GGCCTCCGGAGGGTACTGGAAGG - Intronic
1122847727 14:104509983-104510005 GGCCACAGGAGGCTCCGTGAAGG + Intronic
1122866132 14:104604800-104604822 GGCCGCGGGAGGCTGCGCAGTGG + Exonic
1122904473 14:104795519-104795541 GGGCGCCGGAGGCCGCGGCCCGG - Intronic
1122993430 14:105249524-105249546 GGCCTCCGGAGGCTTCTGAAGGG + Intronic
1123083517 14:105707007-105707029 GGCCCCCCGAGGCTGAGGGCAGG + Intergenic
1124249305 15:28096792-28096814 GGCCTCGGGAGGCCGCGGGTGGG + Intronic
1124341259 15:28890518-28890540 GGCAGGCGGAGGCTTCTGGAAGG - Intronic
1125521029 15:40347905-40347927 GGCTGCGGGAGGCTGGGGCAGGG + Intergenic
1125677682 15:41511524-41511546 GGCGGCCGGAGGCGGCGGTCGGG - Exonic
1126990624 15:54371924-54371946 GGTAGCCAGAGGCTGAGGGAGGG + Intronic
1127674766 15:61228814-61228836 GGGCGGGGGAGGCGGCGGGAAGG - Intronic
1128062370 15:64743108-64743130 GGCTGCCGGAGGCTACATGAAGG - Intronic
1128063749 15:64751459-64751481 GGCAGCAGGATGATGCGGGAAGG - Intronic
1128976431 15:72157174-72157196 GGCTGCCAGGGGCTGAGGGAAGG - Intergenic
1129232133 15:74202820-74202842 GGCAGGCTGAGGCTGGGGGAGGG - Exonic
1129263532 15:74382130-74382152 GGCAGCCTGTGGCGGCGGGAGGG + Intergenic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1130018351 15:80204445-80204467 GGCCGCCCCGGGCTGGGGGAAGG - Intergenic
1130099494 15:80881669-80881691 GGACCTCGGAGGCTGCGGTAAGG + Intronic
1131473276 15:92714612-92714634 GGCCTCCAGGGGCCGCGGGAAGG - Intronic
1132609303 16:807403-807425 GGCGGCCAGAGGGAGCGGGAGGG - Intronic
1132672868 16:1108860-1108882 GGCCCCCCGAGGCTGTGGGAGGG + Intergenic
1132805625 16:1773788-1773810 GTCCACCGCAGGCTGCGGGCCGG - Exonic
1132885196 16:2179379-2179401 AGCCGCGGGAGGCTGGGGCAGGG - Intronic
1133280835 16:4664339-4664361 GGCTGCCGGGGGCTGGAGGAGGG + Intronic
1133296577 16:4756027-4756049 GGCTGCCAGAGGCTAGGGGAGGG + Intronic
1133771616 16:8869770-8869792 GGCCCCCGGAGGCGGCGGTGAGG + Intergenic
1134645018 16:15858533-15858555 GGCGGCCGGTGGCTGCGTGAAGG - Intergenic
1135114114 16:19711325-19711347 GGTGGCAGGAGGCAGCGGGAGGG + Intronic
1135517682 16:23149220-23149242 GGCCGCCGGCGGCGGCGAGCGGG - Exonic
1136292680 16:29285315-29285337 GGGCGCCGGATGCTGCAGGGAGG - Intergenic
1136365451 16:29807162-29807184 GGGCGCCGGAGGCTGCTTCAGGG - Exonic
1136366708 16:29812334-29812356 GGCAGACTGAGGCTGCGGGTAGG + Intronic
1136637962 16:31537676-31537698 TGCGGCCGGCGGCTGCGGGCTGG - Intergenic
1137359673 16:47802359-47802381 GCCTGTCGGAGGCTGGGGGAAGG + Intergenic
1138266136 16:55660999-55661021 GGCTGCAGGAGGCTCTGGGAGGG + Intronic
1138351711 16:56349469-56349491 GGCAGCCGGAGGCTTCTGGGAGG - Intronic
1139567967 16:67791529-67791551 GGCTGTTGGAGGCTGCAGGAAGG + Intronic
1139708867 16:68761241-68761263 GGCTGCCCCAGGCAGCGGGAGGG - Intronic
1141138071 16:81479508-81479530 GGCTGCCAGGGGCTGGGGGAGGG - Intronic
1141699798 16:85637180-85637202 GGCCGCCGGGGGCTGGGGGAGGG - Intronic
1141703978 16:85654783-85654805 GGCCGCTGGAGGCTGCAGGCGGG - Exonic
1141709395 16:85689116-85689138 GGCCGAGGGAGGCTGCGCGCCGG + Intronic
1141736840 16:85859732-85859754 GGCCGCTGGAGGCTAGGGGAGGG + Intergenic
1141828983 16:86498985-86499007 AGGCGCCGGCGGCGGCGGGAGGG - Intergenic
1142044960 16:87919470-87919492 GGCCGCCCGAGGCTGTGGCTTGG - Intronic
1142380684 16:89730303-89730325 TGCCGCCTGAGGCTGCTGTACGG + Intronic
1142950250 17:3472321-3472343 GGCTGCGGGAGCTTGCGGGAGGG + Intronic
1143200763 17:5111725-5111747 AGCCGCCGCTGCCTGCGGGACGG + Intronic
1143822470 17:9575805-9575827 GGCGGGCGGAGTCTGCAGGATGG - Exonic
1144941739 17:18946915-18946937 GGCTGCCAGAGGCTTGGGGAGGG + Intergenic
1147315441 17:39617995-39618017 GGCCGGCCGCGGCGGCGGGAAGG + Intergenic
1147971011 17:44219172-44219194 GGCCGCCGGAGGGGGCGGCGGGG - Intronic
1148086908 17:44999166-44999188 GGTTGCCGGGGGCTGGGGGAAGG - Intergenic
1148617679 17:49013422-49013444 GGCCGCGGGAGGAGGCGGGACGG - Intronic
1148782451 17:50129622-50129644 GGCCGCGGGGGGCTCCGGGCGGG + Exonic
1151615176 17:75205427-75205449 GGCCCCCGGAGACGGCGGGAGGG - Intergenic
1151949809 17:77345145-77345167 GGTTGCCAGAGGCTGGGGGAAGG + Intronic
1152028742 17:77828346-77828368 GGCCTCCAGAGGCTGAGTGAGGG - Intergenic
1152212427 17:79009585-79009607 GGCGGCGGCAGGCTCCGGGACGG + Intronic
1152237453 17:79145907-79145929 GGCCGCCGGGGGCAGGGGGGTGG + Intronic
1152433105 17:80260512-80260534 GGCCGGCGGCGGCGGCGGGCAGG + Intergenic
1152643021 17:81457061-81457083 GGCCGCTTGGGGCTGGGGGAGGG + Intronic
1152663052 17:81551884-81551906 GGCAGCAGGAGTGTGCGGGAGGG + Intronic
1152748332 17:82051403-82051425 GGCCCCCGGAGGCTCCGCGCGGG - Intronic
1152786252 17:82249488-82249510 GGCGGCCGGAGGCTGTGGAAGGG + Exonic
1153319796 18:3761250-3761272 GGTTGCCAGAGGCTGGGGGAGGG - Intronic
1153457215 18:5295264-5295286 GGCCGCGGGAGGGCGGGGGAGGG - Intronic
1153771820 18:8422848-8422870 GGCCACCAGGGGCTGGGGGATGG + Intergenic
1154358783 18:13642241-13642263 GGCCGTCGGAGGCTCAGTGATGG + Intronic
1157529593 18:48409693-48409715 GACTGGCGGAGGCTGCGGGCGGG + Intronic
1157615799 18:48987108-48987130 AGCCTCCAGAGGCTGTGGGAGGG - Intergenic
1160025552 18:75212170-75212192 GGAGGCCGGGGGCCGCGGGACGG + Intronic
1160930707 19:1568343-1568365 GGCCGCGGGAGGCGGCGGGAGGG - Intergenic
1160946825 19:1647607-1647629 GTGCACCGGAGCCTGCGGGAGGG - Intronic
1160967785 19:1754126-1754148 GGCCGCCAGACGCTGCGGCGGGG - Exonic
1161161100 19:2762267-2762289 TGCCCGCGGAGGCTGAGGGAGGG - Intronic
1161456945 19:4374375-4374397 GGTGGCCGGAGGCTCCGTGAGGG + Intronic
1161505107 19:4639566-4639588 GGCCCACGGAGGCGGCTGGACGG + Intronic
1162046909 19:8005862-8005884 GGCCCTCGGAGGCTGACGGAAGG + Intronic
1162301124 19:9845838-9845860 GGCCGCTGGGGGCTGTGGCAAGG + Intronic
1162416866 19:10543768-10543790 GGCGGGGGGAGGCCGCGGGAAGG + Intergenic
1162799428 19:13102771-13102793 GGCCGCCGGGGGCGGGGAGAAGG - Exonic
1162951383 19:14073677-14073699 GGCTGCCAGAGCCTGGGGGACGG + Exonic
1162964896 19:14151040-14151062 GGGGGCCGGGGGGTGCGGGAGGG + Exonic
1163026833 19:14517759-14517781 GGCCGCCGGGGTCCGCGGGGCGG - Intronic
1163052695 19:14696350-14696372 GGCTGCCAGGGGCTGAGGGAGGG - Intronic
1163284998 19:16340994-16341016 GGCTGCCAGGGGCTGGGGGAGGG + Intergenic
1163367723 19:16885268-16885290 GGGTGCCAGAGGCTGGGGGAGGG - Intergenic
1163566360 19:18054004-18054026 GGCTGCCAGGGGCTGGGGGAGGG + Intergenic
1163620008 19:18353650-18353672 GGCTGCCAGGGGCTGAGGGAGGG - Intronic
1163690139 19:18734156-18734178 GGCTGCCAGGGGCTGGGGGAGGG + Intronic
1163725177 19:18919303-18919325 GGCCTCCGGCGGCTCCGGGGAGG - Exonic
1163833495 19:19559259-19559281 GGCCGCCAGAGGCTGGGGAAAGG + Intergenic
1164594940 19:29526438-29526460 GGCCGCCGGCGGCCAGGGGAGGG + Intergenic
1166551234 19:43667680-43667702 GGCCCCAAGAGGCTGGGGGAAGG + Exonic
1167638635 19:50668531-50668553 GGCGGGCGGCGGCTGCGGGGAGG + Exonic
1168145006 19:54415772-54415794 CTCCGCCGGAGGCTGGGGGCCGG + Intronic
1168324159 19:55529779-55529801 CGCCCCTGGAGGCAGCGGGAGGG - Exonic
1168702848 19:58451886-58451908 AGCCGCGGGAGGCTGCTGGCGGG + Intronic
926241527 2:11092658-11092680 GGTTGCCAGAGGCTGCGGGGAGG + Intergenic
926620101 2:15039768-15039790 GGCCCTCAGAGGCTGCCGGAAGG - Intergenic
926801807 2:16665840-16665862 GGCCGCCGCAGCCTGCGAGACGG + Intronic
927517898 2:23682683-23682705 GGGCGCGGGAGGGTGCGGGAGGG - Intronic
927851592 2:26503325-26503347 GGCCGCTGGAGGGCGCGGCAGGG - Intronic
928579471 2:32692400-32692422 GGTTGCCGGGGGCTGGGGGAAGG + Intronic
931728190 2:65130525-65130547 GGCCGACGGAGGCTGGGGGTCGG + Intergenic
932222724 2:70012019-70012041 GGCCGAGGGAGGCTGATGGAGGG + Intergenic
933388411 2:81640156-81640178 GGGAGTGGGAGGCTGCGGGAGGG + Intergenic
935371912 2:102356113-102356135 GGCCGGTGGAGGCTGCAGGTGGG - Exonic
935820454 2:106887521-106887543 GGCAGCTGGAGCCTGCGGGCGGG + Intergenic
935922159 2:108027873-108027895 AGCAGCAGGAGGCTGGGGGAAGG - Intergenic
935971574 2:108534627-108534649 GCCCGCCGGGAGCTGCGGGGCGG - Intronic
936427748 2:112434815-112434837 GTCCTCCGGAGCCTGCAGGAGGG - Intergenic
936576228 2:113657889-113657911 GGGAACCGGAGGCTGCAGGATGG + Intergenic
937154567 2:119709971-119709993 GGCCGCCGGGGACTGGGGAAAGG + Intergenic
937335829 2:121061858-121061880 GCCAGCGGGAGGCTGCAGGAGGG + Intergenic
937512443 2:122611454-122611476 TGCTGCCTGAGGCTGGGGGAGGG - Intergenic
938090027 2:128425406-128425428 GGCAGCCAGGGGCTGTGGGAGGG - Intergenic
938139828 2:128786406-128786428 GGGGGCCAGAGGCTGGGGGAAGG - Intergenic
938277145 2:130037135-130037157 GGTCGCCGGGGGCTTCGGGGTGG - Intergenic
938328115 2:130427908-130427930 GGTCGCCGGGGGCTTCGGGGTGG - Intergenic
938361834 2:130693570-130693592 GGTCGCCGGGGGCTTCGGGGTGG + Intergenic
938438239 2:131300254-131300276 GGTCGCCGGGGGCTTCGGGGTGG + Intronic
941841778 2:170092877-170092899 GGTTGCCGGGGGCTGGGGGAAGG + Intergenic
942116761 2:172735820-172735842 GGCCGCGGGAGCCCGCGGGGAGG + Exonic
944273161 2:197805183-197805205 TGCCGCCGGGGACTGCGTGACGG + Exonic
944515736 2:200510036-200510058 GGCCGCCGGACGCCGCGGGGCGG + Exonic
945157504 2:206855109-206855131 GGTTGCCGCAGGCTGAGGGAGGG + Intergenic
946759652 2:222980751-222980773 GGCCGCCAGAGGCTGGGGATGGG - Intergenic
947354677 2:229279782-229279804 TGCTGCAGGAGGCTGCAGGAGGG + Intergenic
947720859 2:232368461-232368483 GGCTTCCAGAGGCTGAGGGAGGG + Intergenic
947989147 2:234473326-234473348 GTGCGCCGGAGCCTGTGGGAAGG - Intergenic
1169214872 20:3786912-3786934 GGTCGCCGGAGGCCGCAGCACGG - Intronic
1169220565 20:3820158-3820180 GGCCTTAGGAGGCTCCGGGACGG - Intergenic
1172352728 20:34255964-34255986 GGCCTCTGGAGGCTGCGGGTGGG - Intronic
1172485471 20:35295334-35295356 GGGCGCCAGGGGCTGGGGGAGGG - Intergenic
1172974437 20:38895657-38895679 GGCCGCAGGTGGCTGCAGCATGG - Exonic
1175589777 20:60179853-60179875 GGCTGCCAGGGGCTGGGGGAAGG - Intergenic
1176029992 20:63007189-63007211 GGCGGCCGGAGGCGGCGGCCGGG - Intergenic
1176374496 21:6080396-6080418 GTCCTCCGGAGCCTGCAGGAGGG + Intergenic
1178877404 21:36423404-36423426 GGCTGCCGGAGTGTGTGGGATGG + Intergenic
1179748979 21:43457849-43457871 GTCCTCCGGAGCCTGCAGGAGGG - Intergenic
1179888321 21:44323975-44323997 AGCCTACGGAGGCTGCTGGAGGG + Intronic
1180134630 21:45854420-45854442 GGGTGCCAGAGGCTGGGGGAGGG - Intronic
1180195972 21:46194585-46194607 GGCAGACGGAGGCTGGGGGGAGG - Exonic
1180615011 22:17121056-17121078 GGCTGCCGGGGGCGGCGGGAAGG + Exonic
1180875075 22:19171385-19171407 CGCCGCCAGAGGCTCGGGGAGGG + Intergenic
1180876599 22:19177910-19177932 GGCCGGTGGCTGCTGCGGGAGGG - Intronic
1181060767 22:20281090-20281112 GGCCGCTGGAGGCCGTGGGCCGG - Intronic
1181511775 22:23392606-23392628 GGCTGCTGGAGGCTGCGGCTGGG - Intergenic
1182002280 22:26929593-26929615 GGCTGCCAGAGGCTGGGGGAAGG - Intergenic
1182447817 22:30399732-30399754 GGCTGCGGGAGGCTGGGGCAGGG + Intronic
1183517098 22:38272926-38272948 GGCAGCCGGACTCTGCGGGCGGG + Exonic
1183710864 22:39502459-39502481 GGCCGCCGGCGGCTGGGCGGCGG + Intronic
1183980129 22:41534520-41534542 GGCTGCCAGAGGCTGGGTGAAGG + Intronic
1184480174 22:44742013-44742035 GGTCGCCAGACCCTGCGGGAGGG + Intronic
1185343060 22:50300079-50300101 GGGCGCCGGAGTCCCCGGGAGGG - Intronic
949480910 3:4493249-4493271 CGGCGCCTGAGGCTGCGGGGAGG - Intergenic
950096599 3:10334295-10334317 GGCCGCAGGAGTCATCGGGAGGG + Intronic
950125052 3:10505698-10505720 CGCTGCCGGAGGCTGGGGGATGG + Intronic
950224368 3:11221755-11221777 GGCTGCCGGGGGCTGCGGGAAGG - Intronic
950359613 3:12441128-12441150 GGCCGCCTGAGCCTGCCAGATGG + Intergenic
950395439 3:12730433-12730455 GGGTGCCAGAGGCTGCGGGACGG - Intergenic
950453392 3:13078426-13078448 GGCAGCCGTTGGGTGCGGGAGGG - Intergenic
953079446 3:39602054-39602076 GGTTGCCAGAGGCTGGGGGAGGG - Intergenic
953143917 3:40255266-40255288 GGCTGCCAGAGGTTGTGGGAAGG + Intronic
956164045 3:66383108-66383130 GCCCGCAGCAGGCTGCAGGAAGG - Exonic
957486660 3:80870820-80870842 GGCTGAGGGAGGCTGAGGGAAGG + Intergenic
958810921 3:98859159-98859181 GGCAGCAGGAGGCTGGGGGAGGG + Intronic
959122407 3:102248223-102248245 AGCAGCCAGAGGCTGCAGGAAGG - Intronic
959444534 3:106422304-106422326 GGCTGCCAGGGGCTGCGAGAGGG + Intergenic
960205819 3:114896577-114896599 GGCTGCCAGAGGCTGGGGGTGGG + Intronic
961222591 3:125212383-125212405 GGCCTGCGGAGGCCGCGGGGCGG - Intronic
961603362 3:128076894-128076916 GGACGCCGGCAGCTGCGGGGAGG - Intronic
962575656 3:136752667-136752689 GGCCGCCCGCGGCTGGCGGAAGG + Intergenic
964842162 3:161006333-161006355 GGGTGCCAGAGGCTGAGGGAAGG + Intronic
966779337 3:183570469-183570491 GGTTGCCGGGGGCTGGGGGAAGG + Intergenic
967182927 3:186922215-186922237 AGCCGGCGGGGGCTGGGGGAGGG + Intergenic
967670302 3:192225932-192225954 GGCTGCCAGGGGCTGGGGGAAGG + Intronic
968092857 3:195909238-195909260 GGCCGCCGGACGGCGCGGGCTGG - Intronic
968526995 4:1064813-1064835 GGCTGCCAGCGGCTGTGGGATGG - Intronic
968583065 4:1403804-1403826 GGTCGCCGGCGTCTGCGGGAGGG + Exonic
968602851 4:1518500-1518522 GGTCGCCGGGGGCTGCGGAGGGG + Intergenic
968636631 4:1684337-1684359 GGCGGCCGGAGGGGGCGGGGCGG - Intergenic
969053040 4:4386372-4386394 GGCTGCCCCAGGCAGCGGGAGGG - Exonic
969285617 4:6200309-6200331 GGCGGCCGGAGGATGCGGCGCGG - Exonic
969468405 4:7371257-7371279 GGGCGCAGGCAGCTGCGGGACGG - Intronic
969691433 4:8706178-8706200 AGCCCCCCGAGGCTGCGGCAAGG + Intergenic
973705089 4:53573219-53573241 GGCTGCCAGGGGCTGGGGGAAGG + Intronic
975579055 4:75890797-75890819 GGCAGCTGGAAGCTGCTGGAAGG - Intronic
975633035 4:76421088-76421110 GCCCCGCGGAGGCTGCGGGGCGG + Intronic
976431315 4:84966214-84966236 GGCCGGCGGAGGGCGCGGGCGGG + Exonic
980934074 4:139209687-139209709 GGCTGCCAGAGGCTGGGGGGAGG - Intergenic
985087631 4:186329615-186329637 GGAGGCAGGCGGCTGCGGGATGG + Intergenic
985580549 5:693427-693449 GGGCGCCGGACGCTGGGGGCCGG - Intergenic
985629986 5:1009168-1009190 GGGCGGCGGCGGCTGCGGCACGG - Exonic
989475695 5:41870372-41870394 GGCAGGAGGAGGCTGCGGGTTGG + Exonic
992475951 5:77101846-77101868 AGCTGCCAGAGGCTGCGGGGTGG + Intergenic
992645776 5:78809629-78809651 GGCCGCCAGAGCCTGCGGCCAGG + Intronic
992939692 5:81750598-81750620 AGCCGCCGGGGGTGGCGGGAGGG - Intronic
994353825 5:98773826-98773848 GGCGGCCGGAGGCGGCAGGCAGG - Intronic
994955871 5:106531723-106531745 GGCTACCAGAGGCTGGGGGAGGG - Intergenic
998406638 5:141878146-141878168 GGCCGGCGGGAGCTGAGGGAGGG - Intronic
1001548701 5:172586870-172586892 GCCCTCTGGAGGGTGCGGGATGG + Intergenic
1001642717 5:173256496-173256518 AGCCCCCTGAGGCTGGGGGAAGG + Intergenic
1001973589 5:175978311-175978333 GGTTGCCAGAGGCTGAGGGAAGG + Intronic
1002195004 5:177496837-177496859 GGCCGCCCGAGGCTCCAGGCTGG - Intronic
1002243844 5:177865468-177865490 GGTTGCCAGAGGCTGAGGGAAGG - Intergenic
1002296261 5:178232842-178232864 GGCCGCAGGGGCCTGCGGGGCGG - Intergenic
1002670344 5:180861354-180861376 GGCCGACGGCGCCGGCGGGAGGG + Intergenic
1003531835 6:6943589-6943611 GGCTGCCAGGGGCTGGGGGAGGG + Intergenic
1004492302 6:16128875-16128897 GGGCGCCGAGTGCTGCGGGAAGG - Intergenic
1005962390 6:30703449-30703471 GTCCGTCGGAGGCTGCGGCTTGG + Exonic
1006528795 6:34631721-34631743 GGCTGCCAGGGGCTGCAGGAAGG + Intronic
1007110987 6:39313518-39313540 GGCCGTAGGAGCCTGGGGGAAGG - Intronic
1007614482 6:43172013-43172035 GGCCACCGGGGGCTACGGGCCGG + Exonic
1010032811 6:71288565-71288587 GGCCGCCGGGGGCCGCGTGAAGG + Intergenic
1010051155 6:71505699-71505721 GGCTGCCCGATGCTGAGGGAAGG - Intergenic
1010150428 6:72725500-72725522 GGTTGCCAGAGGCTGAGGGAGGG + Intronic
1010353515 6:74904176-74904198 GGCGGCAGCAGGCTGGGGGAGGG + Intergenic
1010955594 6:82087625-82087647 GGCCTCCGGAGGCTGTGGCAGGG - Intergenic
1012428576 6:99141631-99141653 GGCCTCCGGAGGTGCCGGGATGG + Intergenic
1012823074 6:104113070-104113092 GGTCACCAGAGGCTGGGGGAGGG + Intergenic
1015857127 6:137636803-137636825 GGTTGCCAGAGGCTGGGGGAGGG - Intergenic
1016383671 6:143511347-143511369 GGTGGCTGGAGGCTGCGGGTGGG + Intronic
1017883592 6:158579900-158579922 GGCAGCCAGGGGCTGGGGGAAGG + Intronic
1017942957 6:159069058-159069080 GGCCGCTGCAGGCTGGAGGAGGG + Intergenic
1019016898 6:168886435-168886457 GGCCGTCGGAGGCTGTGGCCGGG + Intergenic
1019471112 7:1221543-1221565 GGTTGCCGGGGGCTGGGGGAGGG + Intergenic
1019647791 7:2140292-2140314 GGCGGACGGGGGCTGCTGGAGGG - Intronic
1019929843 7:4216121-4216143 GGCCTCCTGAGGCTGGGGAAGGG + Intronic
1020418277 7:7969670-7969692 GGCCGCCGGCGGCGTCGGGCTGG - Exonic
1020923124 7:14290533-14290555 GGCAGCCTGAGTCTGAGGGAAGG - Intronic
1021407960 7:20295795-20295817 GGTTGCCAGGGGCTGCGGGAAGG - Intergenic
1021717813 7:23474753-23474775 GGGCGCTGGACGCTGGGGGAAGG - Intergenic
1021845338 7:24757558-24757580 GGCCGCCGGAGGCTGCGGGAGGG + Intronic
1021851669 7:24814649-24814671 GGTCGCCCGGGGCTGCAGGAGGG - Intronic
1023963822 7:44950553-44950575 GGCTGCCAGGGGCTGGGGGAAGG - Intergenic
1025977098 7:66378069-66378091 GGCCTCGGGAGGCTGGGGGAAGG + Intronic
1026817116 7:73521841-73521863 GGCCTCCTGAGTGTGCGGGATGG + Exonic
1029456941 7:100676215-100676237 GGCGGCTGGGGGCCGCGGGACGG - Exonic
1029458435 7:100682559-100682581 GGCACCTGGAGGCTCCGGGATGG - Intronic
1029549975 7:101232504-101232526 GGCCGCCGGGCGCTGCGGGGAGG + Exonic
1032587790 7:133163734-133163756 GGTTGCCGGGGGCTGGGGGAAGG + Intergenic
1034291079 7:149932306-149932328 GGCTGCTGAAGGCTGGGGGAAGG + Intergenic
1034494320 7:151410657-151410679 AGCCGCCGGGCGCTCCGGGAGGG - Intronic
1034949254 7:155285924-155285946 GGGTGCCGGAGTCTGGGGGAGGG - Intergenic
1035171046 7:157017734-157017756 GGGCCCCGGAGACTGCGGGGAGG - Intergenic
1036345291 8:7957321-7957343 GTCCTCCAGAGGCTGCAGGAGGG + Intergenic
1036862423 8:12364333-12364355 GTCCTCCAGAGGCTGCAGGAGGG + Intergenic
1037275001 8:17168655-17168677 GGCTGCCAGAGGGTGGGGGAGGG - Intronic
1038540338 8:28385842-28385864 GGGCGCGGGACGCTGCGGCAGGG - Intronic
1038616741 8:29102520-29102542 GAACGCCGGAGGCTCCGGGGAGG + Intronic
1038902272 8:31857200-31857222 GGCGGCAGCAGGCTGGGGGAGGG - Intronic
1039454620 8:37698464-37698486 GGCTGCCGGGGGCGGCGGGCGGG - Exonic
1039592583 8:38762285-38762307 GGGTGCCGGGGGCTGGGGGAAGG - Intronic
1039640851 8:39219209-39219231 TGCTGCCTGAGGCTGGGGGAAGG + Intronic
1040840798 8:51782138-51782160 AGCCCCCGGAGGCTGTGGGTGGG - Intronic
1041464753 8:58146738-58146760 GGCCGCAGGAGCCCGCAGGAGGG + Exonic
1041906496 8:63038808-63038830 GGCGGGCGGGGGCTGCGGCAGGG + Exonic
1042859031 8:73294993-73295015 GCCGGCCGGGCGCTGCGGGACGG + Exonic
1044863018 8:96541675-96541697 GGCTGCCAGGGGCTGAGGGAGGG + Intronic
1045510124 8:102807090-102807112 GGCCGCCGGCTGCTGGGGGTGGG - Intergenic
1048214123 8:132480457-132480479 GGGCGGCGGAGGCGGCGGGGCGG - Exonic
1048329957 8:133464653-133464675 TGCCGGAGGAGGCTGGGGGAGGG + Intronic
1048981259 8:139704230-139704252 GCGCCCTGGAGGCTGCGGGAGGG - Intergenic
1049023772 8:139974838-139974860 GGCAGCCGGAGGCTGCCGGGCGG - Intronic
1049082714 8:140455995-140456017 GGCCGCCAGGGGCTGTCGGAGGG + Intronic
1049320405 8:141993255-141993277 GGCTGCCAGGGGCTGGGGGAGGG - Intergenic
1049671475 8:143872013-143872035 GGCAGCCGGAGCCTGCGTGCTGG + Exonic
1049914683 9:305914-305936 GGTCGCCAGGGGCTGGGGGAGGG + Intronic
1049989405 9:977315-977337 GGCTGGCGGCGGCTGCGGGGCGG - Exonic
1051254000 9:15192987-15193009 TGCTGCCGGAAGCTGTGGGATGG - Intronic
1056039804 9:82651948-82651970 GGCTGCCTGAGGTTGAGGGATGG + Intergenic
1057034705 9:91803383-91803405 GGCTGCCAGAGGCTGGAGGAGGG + Intronic
1057134578 9:92678573-92678595 GGCTGCCAGAGGCTGGGGGAGGG + Intergenic
1058995128 9:110292180-110292202 GGCAGCCGGGGGCTGTGGGCAGG - Intergenic
1060892709 9:127198778-127198800 GGCCCCCGGGGGCAGTGGGAAGG + Intronic
1060945951 9:127569276-127569298 GCCCGCCGGAGGCAGCGGAGGGG - Intronic
1061226038 9:129281565-129281587 GGCCGCCGAGGGCTGGCGGAGGG + Intergenic
1061416192 9:130448163-130448185 GACCTGCGGAGGCTGAGGGAGGG + Intronic
1061495866 9:130973887-130973909 GCCAGCCGGAGGCAGGGGGAGGG - Intergenic
1061515681 9:131088738-131088760 GGCTGCCAGGGGCTGGGGGAGGG - Intronic
1061526595 9:131169985-131170007 GGCTGCCGGAAGCTGGAGGAGGG + Intronic
1061534397 9:131238751-131238773 GGCCGGCCGGGGCTGCGGTATGG - Intergenic
1061623620 9:131827505-131827527 GGCTGCCGGGGGCTGGGGGAGGG + Intergenic
1061674022 9:132205438-132205460 GGCTGCCAGGGGCTGGGGGAAGG + Intronic
1062113474 9:134795466-134795488 GGCATCCAGAGGCTGCTGGAGGG - Intronic
1062343383 9:136103702-136103724 GGGCGGCGGAGGTGGCGGGAAGG + Intergenic
1203770876 EBV:49511-49533 GGCGGCCTGAGCCTGCTGGACGG - Intergenic
1186344677 X:8679622-8679644 GGTTGCCGGGGGCTGAGGGAGGG + Intronic
1186743073 X:12538261-12538283 GGCAGCAGCAGGCTGGGGGAGGG + Intronic
1187651457 X:21413068-21413090 GGCTGCCAGAGGCTGAGGGGAGG - Intronic
1189281280 X:39821449-39821471 GGGCGCCGGGGGCTGAGGGTGGG + Intergenic
1189325454 X:40108569-40108591 GGCGGGCGGAGGCTTCTGGAGGG - Intronic
1190581293 X:51894658-51894680 GGAGGCAGGAGGCTGGGGGAGGG - Exonic
1190641358 X:52484215-52484237 GGCCCTCAGAGGCTGCTGGAGGG + Intergenic
1190646314 X:52528650-52528672 GGCCCTCAGAGGCTGCTGGAGGG - Intergenic
1191038426 X:56052855-56052877 GGCCGCAGGAGGCTGGGGGAGGG - Intergenic
1195702610 X:107716428-107716450 GGCAGCCGGAGGCAGAGGGGCGG - Intronic
1197262969 X:124336451-124336473 GGCAGCCCGAGGCTGAGGGCTGG - Intronic
1197651345 X:129068201-129068223 GGTTGCCAGAGGCTGGGGGAAGG + Intergenic
1200068918 X:153518246-153518268 GGGTGCCCGAGGCTCCGGGAAGG - Intronic
1200093513 X:153646944-153646966 GGCCTCGGGAGGCAGGGGGAGGG - Intronic
1200173698 X:154097447-154097469 CGCCACCGGCGGCGGCGGGAGGG + Intronic
1200233549 X:154458008-154458030 GGTCGCCCGAGGCGGCGGGCGGG + Intergenic
1200239587 X:154486677-154486699 CGCCGCCGGAAGCAGCGAGAGGG + Intergenic