ID: 1021851615

View in Genome Browser
Species Human (GRCh38)
Location 7:24814212-24814234
Sequence CAGTGTGGCCAGAGGACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021851609_1021851615 12 Left 1021851609 7:24814177-24814199 CCAAGCAGAAGGAAATGAAGAAA 0: 1
1: 0
2: 6
3: 91
4: 1097
Right 1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG No data
1021851608_1021851615 13 Left 1021851608 7:24814176-24814198 CCCAAGCAGAAGGAAATGAAGAA 0: 1
1: 0
2: 6
3: 73
4: 687
Right 1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021851615 Original CRISPR CAGTGTGGCCAGAGGACAGT GGG Intronic
No off target data available for this crispr