ID: 1021855575

View in Genome Browser
Species Human (GRCh38)
Location 7:24851770-24851792
Sequence GGTAGGACATGGCACTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021855571_1021855575 30 Left 1021855571 7:24851717-24851739 CCTGATAGATTCAGGGTAAAAAA 0: 1
1: 0
2: 0
3: 17
4: 209
Right 1021855575 7:24851770-24851792 GGTAGGACATGGCACTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021855575 Original CRISPR GGTAGGACATGGCACTTTAA TGG Intronic
No off target data available for this crispr