ID: 1021856087

View in Genome Browser
Species Human (GRCh38)
Location 7:24857795-24857817
Sequence TTTGTGTTGTTTTTTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1890
Summary {0: 1, 1: 0, 2: 12, 3: 154, 4: 1723}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021856085_1021856087 22 Left 1021856085 7:24857750-24857772 CCAAATAATATTGAAAGTCACTG 0: 1
1: 0
2: 1
3: 30
4: 264
Right 1021856087 7:24857795-24857817 TTTGTGTTGTTTTTTGCTGCAGG 0: 1
1: 0
2: 12
3: 154
4: 1723
1021856084_1021856087 23 Left 1021856084 7:24857749-24857771 CCCAAATAATATTGAAAGTCACT 0: 1
1: 0
2: 6
3: 45
4: 568
Right 1021856087 7:24857795-24857817 TTTGTGTTGTTTTTTGCTGCAGG 0: 1
1: 0
2: 12
3: 154
4: 1723

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021856087 Original CRISPR TTTGTGTTGTTTTTTGCTGC AGG Intronic
901600573 1:10420399-10420421 TTTTTTTTTTTTTTTGCTCCTGG + Intergenic
901704448 1:11062790-11062812 TTTGTTTTGTTTTTTGGTGTTGG - Intergenic
901737419 1:11321207-11321229 CTTGTTTTGTTTTTTGAGGCAGG - Intergenic
901737469 1:11321536-11321558 TTTGTTTTGTTTTTTGGTTTTGG - Intergenic
901778801 1:11578870-11578892 TTTTTGTTGTTTTTTGAGACAGG - Intergenic
901855392 1:12041317-12041339 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
902041824 1:13498220-13498242 TTTGTTTTGTTTTTTGGTTGGGG - Intronic
902191760 1:14768497-14768519 TTTGTCTTGCATTTTACTGCAGG - Intronic
902285383 1:15405086-15405108 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
902352470 1:15867597-15867619 TTGTTGTTGTTTTTTGAGGCAGG + Intronic
903066034 1:20700074-20700096 TTTGTTTTGTTTTTTGAGACGGG + Intronic
903098154 1:21000587-21000609 TTTTTGTTTTTTTTTTGTGCTGG - Intronic
903395083 1:22994811-22994833 TTGGTGTTCTTTTTAGATGCAGG - Intergenic
903561627 1:24232370-24232392 TTTTTGTTTTTTTTTTTTGCGGG + Intergenic
903842376 1:26252526-26252548 TTTGTTTTATTTTTTGGAGCCGG - Intronic
903927902 1:26844042-26844064 TTTGTTTTGTTTTTTTGTGATGG + Intronic
904365021 1:30005130-30005152 TTTTTGTCTTTTTCTGCTGCTGG - Intergenic
904596465 1:31649259-31649281 TTTTTTTTTTTTTTTGGTGCTGG - Intergenic
904691617 1:32297373-32297395 TTTGTGTTGTTTTGTAGAGCTGG - Intronic
904770028 1:32876008-32876030 TTTGTTTTTTTTTTTGCAGGAGG + Intergenic
905043469 1:34978399-34978421 TTTGTGTTGTTTTGTGTGCCTGG - Intergenic
905628366 1:39503933-39503955 TTTGTTTTGTTTTTTGAGACAGG - Intronic
905948115 1:41920588-41920610 TTTGTTTTGTTTTTTACCCCAGG + Intronic
906300150 1:44675654-44675676 TTTGTTTTGTTTTTTGAGACAGG - Intronic
906549372 1:46649918-46649940 TTTGTTTTGTTTTTTGAGACAGG - Intronic
906834593 1:49069543-49069565 TGTGTGGTGTTTTTTTCTGAGGG + Intronic
906983562 1:50657549-50657571 TTTGTTTTGTTTTTTGAGACAGG - Intronic
907203315 1:52746700-52746722 TTTTTTTTTTTTTTTGCGGCTGG + Intronic
907295843 1:53453524-53453546 TTTTTTTTTTTTTTTGCAGCAGG - Intergenic
907401351 1:54226801-54226823 TTTTTGTTGTTTTTTGTTTGGGG - Exonic
907479335 1:54733759-54733781 TTTTTTTTTTTTTTTGCGGCGGG + Intronic
907892075 1:58646102-58646124 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
908013774 1:59810914-59810936 TTGGTTTTGTTTTTGTCTGCAGG + Intergenic
909059298 1:70861694-70861716 TTTGTTTTTTTTTTTGCTAATGG - Intronic
909176152 1:72362740-72362762 TTGGTGTTGCTTATTACTGCAGG - Intergenic
909409490 1:75333046-75333068 TTTGTGTTCTTTTTTTCTATAGG - Intronic
909570438 1:77104150-77104172 TTTTTGTTGCTGTTAGCTGCTGG - Intronic
909858783 1:80576084-80576106 TCAGTGTTGGTTTCTGCTGCTGG + Intergenic
910240571 1:85081657-85081679 TTTGTTTTGTTTTTTGAGGCAGG + Intronic
910533972 1:88275196-88275218 TGTGTGTTGTGTTTTGCTGTGGG - Intergenic
910562029 1:88600931-88600953 TTAGTGTTGGTCTCTGCTGCTGG - Intergenic
910791540 1:91056203-91056225 TTTGTATTTTTTTTTCCTGGTGG + Intergenic
910826198 1:91410042-91410064 TTTGTTTTGTTTTTTGTCTCAGG + Intergenic
910937241 1:92494337-92494359 TTTGTTTTGTTTTTTTCAGATGG - Intergenic
911047012 1:93637088-93637110 TTTGTTTTGTTTTTTGAGACAGG - Intronic
911062897 1:93763076-93763098 TTTGTTTTGTTTTTTGAGACAGG + Intronic
911148421 1:94573147-94573169 TTTGTTTTGTTTTTAGCATCTGG + Intergenic
911635643 1:100232606-100232628 TTTGTTTTGTTTTTTGAGACAGG + Intronic
911897829 1:103460519-103460541 TATGTGTTGATTTTTGCTTCTGG - Intergenic
912074284 1:105852476-105852498 TTTTAGTTGTTTATTGCTGCAGG - Intergenic
912772731 1:112479617-112479639 TTTGTGATCTTGTTGGCTGCTGG - Intronic
912840564 1:113035568-113035590 TTTGTTTTGTTTTTTGGAGAAGG + Intergenic
912995394 1:114527915-114527937 TTTGTGTTTTTTTTTGAGACGGG - Intergenic
913247573 1:116883700-116883722 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
913307971 1:117451980-117452002 TTTGTTTTGTTTTTTGAGACAGG - Intronic
913369523 1:118083015-118083037 TTTGTTTTGTTTTTTGAGACAGG + Intronic
913986771 1:143572760-143572782 TTTGTTTTATTTTTGTCTGCAGG + Intergenic
914201318 1:145487895-145487917 TTTGTTTTTTTTTTTGATACAGG + Intergenic
914219326 1:145664643-145664665 TTTTTGTTGTTTTTTGAGACAGG - Intronic
914471910 1:147987513-147987535 TTTTTGTTGTTTTTTGAGACAGG - Intronic
914478253 1:148042414-148042436 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
914886116 1:151585718-151585740 TGTGTGTTGCTGTTTTCTGCAGG + Intergenic
914944499 1:152052033-152052055 TTTCTGTTTTTTTTTTCAGCAGG + Intergenic
915050688 1:153068968-153068990 TTTGTATTGTTTTCCACTGCGGG - Intergenic
915114447 1:153587394-153587416 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
915210594 1:154306036-154306058 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
915920392 1:159971927-159971949 TTTGTTTTGTGTTTTGGTGGCGG - Intergenic
915941373 1:160120587-160120609 TTTGTTTTGTATTTAGCAGCAGG + Intronic
916191085 1:162178971-162178993 TTTGTGGGGTTTTTTGGTGGGGG + Intronic
916232144 1:162550997-162551019 TTTGTGTTTTTGTTGGCTGGAGG + Intergenic
916285462 1:163100481-163100503 TCAGTGTTGGTCTTTGCTGCTGG - Intergenic
916453828 1:164949685-164949707 TTTGTATTCTTTTTTGTTTCTGG - Intergenic
916946057 1:169728623-169728645 TTTGTGTTATGTTTTGCTACTGG + Intronic
917106839 1:171500901-171500923 TTTGTTTTGTTTTTTGAGACAGG + Intronic
917121372 1:171647516-171647538 TTTGTTTTGTTTTTTGAAGATGG - Intronic
917130090 1:171732529-171732551 TTTGTGAGGTTTTTTGCTACAGG - Intronic
917247873 1:173024166-173024188 TTAGTGTTGGTCTCTGCTGCTGG + Intergenic
917575576 1:176317979-176318001 TTTTTTTTTTTTTTTTCTGCTGG + Intergenic
917651200 1:177079126-177079148 TTTGTGTTGCTTTTTCTTCCTGG - Intronic
917986281 1:180322972-180322994 TTTTTCTTCTTTTTTGATGCAGG + Intronic
918260151 1:182788585-182788607 TTTGTATTTTTTTTTCCTGTAGG + Intergenic
918288764 1:183085366-183085388 TTTGTTTTGTTTTTTGAGTCAGG + Intronic
918517285 1:185376918-185376940 TTTTTCTTTTTTTTTGCTACTGG - Intergenic
918746744 1:188210922-188210944 TTTTTGTTGTTTTTTGACACAGG - Intergenic
918765646 1:188479881-188479903 TTTATGTTCTTTATTGCTTCAGG + Intergenic
918861370 1:189830749-189830771 TTTGTTTTGTTTTTTGGGGGGGG + Intergenic
919353695 1:196494402-196494424 TTTTTGTTGTTTTTTGGTGACGG + Intronic
919402304 1:197134411-197134433 TTTTTTTTCTTTTTTGCTGTTGG - Intronic
919436198 1:197564388-197564410 TTTTTTTTTTTTTTTGCTGGTGG - Intronic
919595379 1:199555313-199555335 TTTTTCTTGTTTTTTGATGTAGG - Intergenic
919642584 1:200059919-200059941 TTTTTGTTGTTCTTGGCTGTGGG - Intronic
919883537 1:201916507-201916529 TTTGTTTTGTTTTTTGAGACAGG - Intronic
920094407 1:203476835-203476857 TTTTTATTTTTTTTTCCTGCAGG + Intronic
920241073 1:204551046-204551068 TTTGTTTTGTTTTTTGAGACAGG + Exonic
920273237 1:204783050-204783072 TTGTTGTTGTTTTTTGCTTTGGG - Intergenic
920492220 1:206425538-206425560 TTTGTTTTGTTTTTTGAGACAGG + Intronic
920605051 1:207373595-207373617 TTTTTGTTGTTTTTTTTTTCAGG - Intergenic
920775540 1:208933160-208933182 TTTTTTTTTTTTTTTGCTTCAGG + Intergenic
921197678 1:212775598-212775620 TTTGTTTTGTTTTTTTTTTCTGG - Intronic
921213261 1:212917338-212917360 TTTTTTTTTTTTTTTGCTCCAGG + Intergenic
921635359 1:217486404-217486426 TTTGTTTTGTTTTTTGAGACAGG + Intronic
922129172 1:222759588-222759610 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
922168350 1:223134434-223134456 TTTTTGCTGTTTTTTGATGCTGG - Intronic
922252128 1:223859100-223859122 TTTGTTTTGTTTTTTGTAGACGG + Intergenic
922299092 1:224280176-224280198 TTTGTTTTTTTTTTTTTTGCTGG + Intronic
922346558 1:224701198-224701220 TTTTTTTTTTTTTTTGCTGGAGG + Intronic
922573894 1:226649821-226649843 TTTGTTTTGTTTGTTTTTGCTGG - Intronic
922723579 1:227911436-227911458 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
922876242 1:228941960-228941982 TTTGTTTTTTTTTTAACTGCAGG + Intergenic
922904143 1:229160974-229160996 TTTTTTTTTTTTTTTACTGCAGG - Intergenic
923082129 1:230668081-230668103 TTTGAGATATTTATTGCTGCTGG + Intronic
923385541 1:233462165-233462187 TTTCTGTTTTTGTTTTCTGCAGG + Intergenic
923568933 1:235097521-235097543 TTGTTGTTGTTTTTTGAGGCGGG + Intergenic
923741516 1:236659168-236659190 TTTGTTTTTTTTTTTGAGGCAGG + Intergenic
923771710 1:236943240-236943262 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
923998762 1:239527110-239527132 TTTGTTTTGTTTTTTGAGACAGG - Intronic
924003060 1:239575143-239575165 CTTGTTTTGTTTTTTCCAGCTGG + Intronic
924086613 1:240458153-240458175 TTTGTGTTTATTTTTGGTGCTGG + Intronic
924201517 1:241664120-241664142 ATTGTTTTGTTTTTTGTTCCAGG + Intronic
924270589 1:242328066-242328088 TTTGTTTTGTTTTTAGCAGCAGG - Intronic
924292342 1:242549876-242549898 TTTGTTTTGTTTTTTGGAGATGG + Intergenic
924299397 1:242621936-242621958 ATGGAGTTGTGTTTTGCTGCAGG - Intergenic
924543546 1:245003900-245003922 TTTGTTTTGTTTTTAGAGGCAGG + Intronic
924684097 1:246269572-246269594 TTTGTTTTGTTTTTTGAGGCAGG + Intronic
924954938 1:248917017-248917039 TTTGAGTTGTTTTTTGATGAAGG + Exonic
1062891987 10:1069393-1069415 TTTTTTTTTTTTTTTGCAGCAGG + Intronic
1062948884 10:1481284-1481306 TTTGAGTTTGTTTTTGCAGCTGG - Intronic
1063131331 10:3180244-3180266 TTTGTGTTGCTTTAAGCTACTGG - Intergenic
1063242502 10:4185811-4185833 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1063540500 10:6928778-6928800 TTTTTTTTTTTTTTTTCTGCTGG + Intergenic
1063610719 10:7559854-7559876 TTTGTTTTGTTTTTTTTTGACGG + Exonic
1063798581 10:9543142-9543164 TTTGTTTTGTTTTTTTCAGACGG + Intergenic
1063882800 10:10548302-10548324 GTTGTGTTGTTTCTTCCTGGAGG + Intergenic
1063986671 10:11511792-11511814 TTTATTTTATTTTTTGCTGTAGG - Intronic
1064083713 10:12328923-12328945 TTTGTTTTGTTTTTTGTTTTTGG - Intergenic
1064112094 10:12548455-12548477 TTTTTTTTTTTTTTTGCTGGGGG + Intronic
1064182511 10:13130922-13130944 GTTGTTTTGTTTTTTGAGGCAGG + Intronic
1064182662 10:13132519-13132541 TTTGTTTTGTTTTTTGAGGCAGG + Intronic
1064359574 10:14651595-14651617 TTTGTTTTGTTTTTTGAGACGGG - Intronic
1064446858 10:15402423-15402445 TTTTTCTTCTTTTTTGCTGTAGG - Intergenic
1064740595 10:18429971-18429993 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1064775734 10:18774450-18774472 TTTGTTTTGTTTTTTGTTTTTGG - Intergenic
1065220694 10:23492895-23492917 TTTATTTTGTTTTTTGGTGGCGG + Intergenic
1065231682 10:23605079-23605101 TTTTTGTTGTCTTTTTCTGTAGG + Intergenic
1065435973 10:25704030-25704052 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1065511241 10:26480308-26480330 GTTGTGTTGTGTGCTGCTGCTGG + Intronic
1065626291 10:27632341-27632363 TTTGTTTTGTTTGTTGTTGTTGG - Intergenic
1065719135 10:28608554-28608576 TTTGTTTTGTTTTTTGTTTTTGG + Intronic
1065752877 10:28904216-28904238 TTTCTGTTTTCTTTTTCTGCTGG + Intergenic
1066142646 10:32522767-32522789 TTTTTCTTCTTTTTTGATGCAGG + Intronic
1066166891 10:32798266-32798288 TCAGTGTTGGTCTTTGCTGCTGG + Intronic
1066665311 10:37777177-37777199 TTTGTTTTGTTTTTCCCTGCAGG - Intronic
1066714358 10:38270728-38270750 TTTGTTTTGTTTTTAGCAACAGG + Intergenic
1067114770 10:43426624-43426646 TTTTTGTTTTTTTTTGAGGCAGG - Intergenic
1067146237 10:43695727-43695749 TTTGTTTTGTTTTCTGCCGGGGG + Intergenic
1067295630 10:44973793-44973815 TGTGTGTTGGTGTATGCTGCGGG + Intronic
1067314944 10:45152189-45152211 GTTGTTTTGTTTTTTGAGGCAGG + Intergenic
1067495879 10:46759655-46759677 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1067561762 10:47309547-47309569 TTGTTGTTGTTGTTTGCTACGGG + Intronic
1067598776 10:47580734-47580756 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1067846745 10:49729843-49729865 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1068010473 10:51443487-51443509 TTTCTATTGTTTTTTTCTTCAGG + Intronic
1068079009 10:52295074-52295096 TGTTTGTTGTTTTTTGGTTCAGG - Exonic
1068690927 10:59913216-59913238 TGTGTTTTCTTTTTTGCTGCAGG - Intergenic
1068925785 10:62536316-62536338 TTTGTTTTGTTTTTTGATACAGG - Intronic
1069047064 10:63753855-63753877 TTTGTTTTGTTTTTTGTCGGGGG - Intergenic
1069650403 10:70042965-70042987 TTTCTGATGCTTTTTGCAGCAGG + Intergenic
1069682264 10:70293663-70293685 TTGGGGTTATTTTTTTCTGCCGG - Intergenic
1069718631 10:70536293-70536315 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1069851199 10:71406200-71406222 TTTCTGTTGCTTTTTGCTTTTGG + Intronic
1070250849 10:74771783-74771805 TTTGTTTTGTTTTTTGAGACTGG + Intergenic
1070308600 10:75256213-75256235 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1070398838 10:76035290-76035312 TTTTTATTTGTTTTTGCTGCGGG - Intronic
1070823480 10:79376554-79376576 TTTGTGTCTGTTTTTGCTCCTGG - Intergenic
1071013792 10:80970711-80970733 TTAGTGTTGTTCTCTGCTGCTGG + Intergenic
1071219390 10:83445953-83445975 CTTATGTGGTTTTTTGCTGCTGG + Intergenic
1071327527 10:84531846-84531868 TTTCTTTTGTTTTTTGCTTTTGG + Intergenic
1071617462 10:87088390-87088412 TATGTGTTTTTTGTTCCTGCAGG - Intronic
1071682924 10:87725699-87725721 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1071685304 10:87748777-87748799 TTTTTGTTGTTTTTTTCTTTCGG + Intergenic
1072268860 10:93756133-93756155 TGTGTGTTGTTTTTTACGGAAGG - Intergenic
1072295697 10:94007582-94007604 TTTTTTTTTTTTTTTGCTACTGG + Intronic
1072572481 10:96670886-96670908 TTTGTGTTATTTTATGCATCTGG - Intronic
1072629655 10:97136505-97136527 TTTGTTTTGTTTTTTGATGGGGG - Intronic
1072976807 10:100065959-100065981 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1073245303 10:102086212-102086234 CTTGTTTTGTTTTTGGTTGCAGG - Intergenic
1073307101 10:102511714-102511736 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1073618582 10:105023542-105023564 TTTTTTTTGTTTTTTGCTTGGGG + Intronic
1073974250 10:109082561-109082583 TTATTTTTGTTGTTTGCTGCAGG - Intergenic
1074055271 10:109918106-109918128 TTTGTTTTTTTTTTTGAGGCAGG - Intronic
1074256410 10:111806971-111806993 TTTGTTTTGTTTTTCGAGGCAGG + Intergenic
1074411423 10:113231750-113231772 TTTGTTTTGTTTTTTGTTTGGGG - Intergenic
1074492619 10:113952653-113952675 TTTGTTTTGTTTTTAACTCCAGG + Intergenic
1074645328 10:115444311-115444333 TTTCTTTTGTTTTTTGGTGCAGG + Intronic
1074740390 10:116480567-116480589 TTTGTTTTGTTTGTTTTTGCTGG + Intergenic
1074838092 10:117318974-117318996 CTTGTTTTGTTTTATTCTGCAGG - Exonic
1075055359 10:119214525-119214547 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1075606926 10:123818367-123818389 TTAGTGTTGGTCTCTGCTGCTGG - Intronic
1075685264 10:124360378-124360400 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1076239069 10:128888970-128888992 ATTGTGTTGTTTTTCTCTGATGG - Intergenic
1076407718 10:130224177-130224199 ATTGTTTTTTTTTTTGCTGGGGG + Intergenic
1076891416 10:133285818-133285840 TTTTTGTTGTTTTGTTCTGATGG - Intronic
1077435637 11:2537690-2537712 TTTGTGGGGTTTTTTGTTGTTGG + Intronic
1078130695 11:8611849-8611871 TTTGTTTTGTTTTTTGAGACGGG - Intergenic
1078275423 11:9840245-9840267 TTTTTTTTTTTTTTTGCGGCTGG - Intronic
1078322212 11:10346511-10346533 TTTGTTTTGTTTTTTGATTCAGG + Intronic
1078389262 11:10922008-10922030 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1078597540 11:12701383-12701405 TTTGTTTTGTTGTTTGCTACAGG - Intronic
1078606571 11:12782122-12782144 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1079039012 11:17044681-17044703 TTTGTGTTAATTTTTGCACCTGG - Intergenic
1079170547 11:18090814-18090836 TTGGTGTTGCTTTATACTGCAGG + Intronic
1079259006 11:18859755-18859777 CATCTGTTGTTTTTTGCTGGAGG - Intergenic
1079348460 11:19672931-19672953 TTTGTGTGTTTGTTTGCTCCTGG + Intronic
1079530752 11:21449707-21449729 TTTGAGTTCATTTTTGCAGCTGG + Intronic
1079610948 11:22432302-22432324 TTTGTTTTGTTTTTTGTTTCAGG + Intergenic
1079695885 11:23482112-23482134 TTTGTTTTATTTTTTGATACAGG - Intergenic
1079698546 11:23514969-23514991 TTTGTGTTGTTTCTTGCTCATGG + Intergenic
1079726314 11:23884333-23884355 TTTGGCCTGTTTATTGCTGCTGG + Intergenic
1079779476 11:24582311-24582333 TTTTTTTTTTTTTTTGCTGAGGG + Intronic
1079834758 11:25320560-25320582 TTTTTTTTTTTTTTTGCTGGAGG + Intergenic
1079845830 11:25466567-25466589 TTTTTGTTCTTATTTGCTTCAGG - Intergenic
1079891719 11:26064073-26064095 TTTGGGTTGTTTCCTGCTGCAGG - Intergenic
1079945918 11:26740590-26740612 TTTGTTTTTTTTTTTTCTGGAGG + Intergenic
1080034164 11:27694591-27694613 TTTTTTTTTTTTTTTGGTGCTGG + Intronic
1080042814 11:27776941-27776963 TTTGTCTTGTTGTTTGCTATTGG - Intergenic
1080185285 11:29476123-29476145 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1080342830 11:31287209-31287231 TTTGTTTTGTTTTGTTTTGCAGG - Intronic
1080359552 11:31496112-31496134 TTTGTTTTTTTTTTTTTTGCGGG - Intronic
1080479369 11:32630329-32630351 TTTGTTTTGTTTTGTTTTGCGGG + Intronic
1080536829 11:33230020-33230042 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1080597834 11:33791138-33791160 TTTGTGTTGTTTTGTTGTGGTGG + Intergenic
1080799103 11:35592923-35592945 TTTTTTTTTTTTTTTGCTGTTGG - Intergenic
1080829822 11:35881475-35881497 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1081032718 11:38106847-38106869 TTAGTGTTCTTTTTGTCTGCAGG + Intergenic
1081065338 11:38533956-38533978 TCTGTGTTGGTCTCTGCTGCTGG + Intergenic
1081378419 11:42386865-42386887 TCAGTGTTGGTCTTTGCTGCTGG - Intergenic
1081381474 11:42421463-42421485 TTTTTGTTGTTTTTTGAGACAGG - Intergenic
1081610782 11:44562106-44562128 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1081956233 11:47096805-47096827 TTTTTTTTTTTTTTTTCTGCTGG - Intronic
1082178593 11:49090816-49090838 TTTTGTTTGTTTTTTGCTCCTGG - Intergenic
1082671947 11:56044948-56044970 TTTTTTTTTTTTTTTGCTGGTGG - Intergenic
1082691708 11:56312836-56312858 TCTGTGTTGTTCACTGCTGCTGG - Intergenic
1082868647 11:57922866-57922888 TTTGTTTTGTATTTTGTTGTTGG - Intergenic
1082999792 11:59280801-59280823 TCCGTGTTGGTTTCTGCTGCTGG - Intergenic
1083023517 11:59530841-59530863 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1083156657 11:60827509-60827531 TTTCTGTACTTTTTTGCTGATGG + Intergenic
1083458860 11:62797698-62797720 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1083493668 11:63031934-63031956 TTTGTTTTGTTTTTTTTTGGGGG - Intergenic
1083553974 11:63611111-63611133 TGTGTTTTGTTTTTTTCTGCAGG + Intronic
1083668945 11:64289884-64289906 TTTGTTTTGTTTTTTGAAGCAGG + Intergenic
1083789997 11:64978296-64978318 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1084226684 11:67719798-67719820 TTTGTGTTAATTTTTGCACCTGG + Intergenic
1084260133 11:67971583-67971605 TTTGTGTTAATTTTTGCACCTGG + Intergenic
1084754540 11:71228021-71228043 TTTGTGTTGTTTTTTTTTCTTGG - Intronic
1084808506 11:71597054-71597076 TTTGTGTTAATTTTTGCACCTGG - Intronic
1084812636 11:71623674-71623696 TTTGTGTTAATTTTTGCACCTGG - Intergenic
1085183256 11:74553992-74554014 TTTTTTTTTTTTTTTGCGGCAGG + Intronic
1085370293 11:75997325-75997347 TCTGTGTTTTGTTTTGTTGCTGG + Intronic
1085372355 11:76020659-76020681 TTTTTTTTTTTTTTTGCTGCAGG + Intronic
1085373933 11:76040550-76040572 TTTGTTTTGTTTTTTGGTTGGGG + Intronic
1085672323 11:78479502-78479524 TTTTTGTTGTTTTTTGAGACAGG - Intronic
1085748464 11:79136510-79136532 TCAGTGTTGTTCTCTGCTGCTGG - Intronic
1085964612 11:81506933-81506955 TTTCTGTTATTTATAGCTGCTGG + Intergenic
1086258139 11:84904927-84904949 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1086319487 11:85629608-85629630 TTTGTTTTGTTTTTTGTTTTTGG + Intronic
1087024351 11:93634969-93634991 TTTGTTTTGTTTTTCACTGTAGG - Intergenic
1087280759 11:96207439-96207461 TCTGTGTTGAGTTTGGCTGCTGG - Intronic
1087368640 11:97252990-97253012 TTTGTGTTTTTCTTTCCTGGGGG - Intergenic
1087374146 11:97321482-97321504 TTAGTGTTGGTCTCTGCTGCTGG - Intergenic
1087568520 11:99894508-99894530 GTTTTTTTTTTTTTTGCTGCTGG - Intronic
1087824984 11:102754904-102754926 TTTTTTTTTTTTTTTGCTGCTGG - Intergenic
1087884599 11:103463744-103463766 TTTGTTTGGTTATTTGCGGCAGG - Intronic
1087940949 11:104096237-104096259 TTTTTGTAGTTTTTTTTTGCAGG - Intronic
1088265554 11:107984538-107984560 TCAGTGTTGGTTTCTGCTGCTGG - Intergenic
1088327522 11:108616221-108616243 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1088388353 11:109285190-109285212 TTTATTTTTTTTTTTTCTGCTGG + Intergenic
1088631077 11:111774370-111774392 TTTGTTTTGTTTTTTGGAGACGG - Intergenic
1088657647 11:112015808-112015830 TTTTTTTTTTTTTTTGCGGCAGG + Intronic
1088838000 11:113594970-113594992 TTTGTTTTGTTTTTGGCTTGTGG + Intergenic
1088950981 11:114569631-114569653 TTGTTGTTGTTTTTTGAGGCTGG + Intergenic
1089211296 11:116804994-116805016 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1089348224 11:117805544-117805566 TTGTTTTTGTTTTTTACTGCAGG + Intronic
1089421639 11:118336464-118336486 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1089815283 11:121167422-121167444 TTTGTTTTGTTTTTAGCAACAGG - Intronic
1089881832 11:121781373-121781395 TGTGTTTTCTTTTTTTCTGCAGG + Intergenic
1089990793 11:122857914-122857936 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1090428120 11:126624327-126624349 TTTGTTTTGTTTTTTCCTAGTGG - Intronic
1090804622 11:130195238-130195260 TTTTTGTTGTTTTTTGAGACAGG - Intronic
1090915184 11:131156791-131156813 TTTCTGTTGTTTGATGATGCCGG + Intergenic
1090923338 11:131228009-131228031 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1091051878 11:132379692-132379714 TTAGTGTTGGTTTCTCCTGCTGG - Intergenic
1091245127 11:134086819-134086841 GTTGTTTTGTTTTTTGATGCGGG + Intronic
1091560554 12:1609608-1609630 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1091721289 12:2815868-2815890 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1091790162 12:3267629-3267651 TTTGTTTTGTTTTGTGCTTCTGG - Intronic
1092086034 12:5761051-5761073 TTTTTTTTTTTTTTTGCTGTGGG - Intronic
1092181349 12:6448986-6449008 TTTGTTTTGTTTTTTGTTGGTGG + Intronic
1092272529 12:7034629-7034651 TCTGTGTTGGTCTCTGCTGCTGG - Intronic
1092282210 12:7106721-7106743 TTTGTTTTGTTTTTTGGTGGGGG - Intronic
1092368660 12:7898243-7898265 TTTCTGTCATTTTTTCCTGCAGG + Intergenic
1092431386 12:8412129-8412151 TTTGTGTTAATTTTTGCACCTGG + Intergenic
1092434339 12:8434746-8434768 TTTGTGTTAATTTTTGCACCTGG + Intergenic
1092693766 12:11145179-11145201 TTTGTTTTGTTTTTTGTTTTTGG + Intronic
1092757490 12:11777449-11777471 TTTTTGTTTTTTTTTTCTTCTGG + Intronic
1092806854 12:12231991-12232013 TTTGTTTTTTTTTTTGAGGCAGG - Intronic
1092839824 12:12529114-12529136 TTTTTGTTGTTTTTTGAGACAGG + Intronic
1093023490 12:14223948-14223970 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1093039213 12:14359771-14359793 TTTTTTTTTTTTTTTGCTCCTGG + Intergenic
1093452311 12:19330043-19330065 TTTGTTTTGTTTTTTGAAACAGG - Intronic
1093469580 12:19486395-19486417 TTTGTTTTGTTTTTTGAGACGGG + Intronic
1093526260 12:20106405-20106427 CTTATGTGATTTTTTGCTGCAGG - Intergenic
1093841665 12:23909947-23909969 TGTTTTTTGTTTTTTGCTGCTGG + Intronic
1093889435 12:24501819-24501841 TTTGTTTTGTTTTTTGAGGCAGG - Intergenic
1094034144 12:26048755-26048777 TTTGTTTTGTTTTTTTCAGACGG + Intronic
1094100931 12:26761404-26761426 TTTGTTTTGTTCTTTGTTGGTGG - Intronic
1094175311 12:27535417-27535439 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1094404522 12:30101447-30101469 TTTGTGTTAATTTTGGCTGTGGG + Intergenic
1094485256 12:30921226-30921248 TTTTTTTTTTTTTTTGCTACAGG - Intergenic
1094500122 12:31013581-31013603 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1095134080 12:38576752-38576774 TTTCTGTTCTTTTTTGATGAAGG - Intergenic
1095144203 12:38704919-38704941 TTTTTTTTTTTTTTTGCTGATGG + Intronic
1095164552 12:38956421-38956443 TTTGTGTAGGTCTTTGCTGCTGG + Intergenic
1095181287 12:39149354-39149376 TTTTTTTTTTTTTTTGCTGTTGG + Intergenic
1095380603 12:41586391-41586413 TTTCTCTTGTTGTTTGCTGTTGG + Intergenic
1095465494 12:42484004-42484026 TTTTTTTTTTTTTTTACTGCGGG - Intronic
1095614596 12:44173073-44173095 TTTGTTTTGTTTTTTGTTTTTGG + Intronic
1095641446 12:44490062-44490084 TTTGTGTTTTTTTGAGCTTCTGG - Intergenic
1095652044 12:44622860-44622882 TTTATCTTGTATTTTGCTGCAGG - Intronic
1095738631 12:45585063-45585085 TCAGTGTTGGTTTCTGCTGCTGG - Intergenic
1095965924 12:47866988-47867010 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1096125909 12:49119358-49119380 TTTGTTTTGTTTTTTGGAGACGG - Intergenic
1096371295 12:51071252-51071274 TTTTTTTTTTTTTTTGATGCAGG - Intronic
1096434352 12:51576061-51576083 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1096462997 12:51833051-51833073 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1096507284 12:52102211-52102233 TTTGTGTTAATTTTTGCACCTGG - Intergenic
1096675200 12:53222346-53222368 TTTTTGTTGTTGTTTGCTGCTGG - Intronic
1096735102 12:53647064-53647086 TTAGTGTTGGTCTCTGCTGCTGG - Intronic
1096835315 12:54346848-54346870 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1097050459 12:56220201-56220223 TTTGTTTTGTTTTTTTTGGCGGG + Intronic
1097110990 12:56658007-56658029 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1097204310 12:57307322-57307344 TTTGTTTTGTTTTTTGAGACGGG + Intronic
1097232554 12:57521463-57521485 TTTGTTTTGTTTTTTGTTTTTGG - Intronic
1097406200 12:59193772-59193794 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1097665076 12:62468949-62468971 TTTGTTTTGTTTTTTGATTTTGG + Intronic
1097683243 12:62668910-62668932 ATTTTGTTGTGTTCTGCTGCTGG - Intronic
1097684424 12:62678116-62678138 TTTGTGTTGTTTTTAGAGACAGG + Intronic
1097845816 12:64364276-64364298 TTTGTTTTGTTTTTTGAGGCAGG - Intronic
1097898219 12:64847486-64847508 TTTTTCTTGTTTTTTGATGTAGG + Intronic
1098117705 12:67197975-67197997 TTTGTGTTGTTTTTTTCACATGG - Intergenic
1098207243 12:68124790-68124812 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1098420359 12:70290232-70290254 TTTTTGTTTTTTTTAGCTTCTGG + Intronic
1098554384 12:71802222-71802244 TTTGTATTTTTTTTTGCGGGGGG + Intergenic
1098671267 12:73234093-73234115 TTTGTTTTGTTTTTTCCTTCAGG - Intergenic
1098828131 12:75325636-75325658 TTTGTTTTGTTTTTTTCTTAAGG + Intronic
1098842280 12:75490563-75490585 TTGTTGTTGTTTTTTTTTGCGGG - Intronic
1098865659 12:75760365-75760387 TTTTTTTTTTTTTTTTCTGCAGG + Intergenic
1098971267 12:76859340-76859362 TTTGTGGTGTTTTTATCTGGTGG + Intronic
1099225019 12:79959020-79959042 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1099502819 12:83434379-83434401 TTTTTTTTTTTTTTTGCTGTTGG + Intergenic
1099689907 12:85938959-85938981 TCAGTGTTGGTCTTTGCTGCTGG - Intergenic
1099804188 12:87497394-87497416 TTTTTGTTTTTTTTTGCCTCAGG + Intergenic
1099835460 12:87905577-87905599 TCTGTTTTGTTTTTTTCTGGTGG - Intergenic
1099870645 12:88345241-88345263 TTTGTTTTTTTTTTTGCAGGTGG + Intergenic
1099984309 12:89645623-89645645 TTTGTATTTGCTTTTGCTGCTGG - Intronic
1099992860 12:89744270-89744292 TTTGTTTTGTTTTTAACTCCTGG + Intergenic
1100215997 12:92449192-92449214 TTTGTTTTGTTTTTAACTGTAGG + Intergenic
1100233948 12:92638441-92638463 TTTGAGTTTTTTTTTTCTGTAGG - Intergenic
1100483114 12:94998730-94998752 TTTATTTTATTTTTTGCAGCTGG - Intronic
1100648077 12:96552347-96552369 TTTTTGTTGTTTTTTGAAACAGG + Intronic
1100825061 12:98467415-98467437 TTTGTTTTGTTTTTTGGAGATGG + Intergenic
1100981100 12:100163243-100163265 TTTTTTTTTTTTTTTGCTGCAGG + Intergenic
1101025107 12:100595409-100595431 TTTGTTTTGTTTTTTGTGGAGGG + Intronic
1101453225 12:104801087-104801109 TTTGTGATGGTTTTTGTTACTGG - Intergenic
1101570088 12:105945934-105945956 TTTGTGTTGCTTTGTGTGGCTGG - Intergenic
1101580133 12:106035424-106035446 TTTTTTTTTTTTTTTGATGCAGG + Intergenic
1101619610 12:106372276-106372298 TTTCTGTTATTTTTTTCTGGGGG + Intronic
1101697239 12:107138298-107138320 TCAGTGTTGTTCTCTGCTGCTGG + Intergenic
1101857229 12:108453831-108453853 TTTGTGTTTTGTTTTGTTACAGG - Intergenic
1101860022 12:108475273-108475295 TTTGTTTTGTTTTTTTTTGATGG - Intergenic
1101922746 12:108946098-108946120 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1101930636 12:109010917-109010939 TCTGTTTTGTTTTTTGAGGCAGG + Intronic
1101938129 12:109075844-109075866 TTTTTTTTTTTTTTTGCTGTTGG + Intronic
1101956650 12:109217792-109217814 TTTTTGTTGTTTTTTGAGACAGG - Intronic
1102333028 12:112051703-112051725 TTTGTTTTATGTTTTGCTGATGG - Intronic
1102416808 12:112770349-112770371 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1102663163 12:114547250-114547272 TTTGTGGTATTTTGTGGTGCTGG + Intergenic
1102664885 12:114563375-114563397 TTTGTGGTATTTTGTGGTGCTGG - Intergenic
1102795822 12:115688035-115688057 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1102935787 12:116895978-116896000 TTTGTTTTGTTTTTTTCAGACGG - Intergenic
1103378363 12:120474423-120474445 TTTATGTTGTTTTTTTCAGTTGG - Intronic
1103449981 12:121021913-121021935 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1103668978 12:122595766-122595788 TCTGTGATGTTTTATGGTGCAGG + Intronic
1103756844 12:123214529-123214551 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1103776999 12:123373533-123373555 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1103834493 12:123808036-123808058 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1104012532 12:124941995-124942017 TTTGTGTTTTTTTTTCCAGATGG + Intergenic
1104111439 12:125708776-125708798 TTTCTGTTGCTTTCTGCAGCCGG + Intergenic
1104182969 12:126400058-126400080 TTTGTTTATTTTTTTGCTGTTGG - Intergenic
1104342001 12:127958982-127959004 TTTGTTTTGTTTTTTCTTGACGG - Intergenic
1104996642 12:132662029-132662051 TTTGTGTTGCTTCGTGGTGCTGG + Intronic
1105371644 13:19806886-19806908 TTTGTTTTGTTTGTTGTTGTTGG - Intergenic
1105449987 13:20490909-20490931 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1105559216 13:21474690-21474712 TTTTTCTTTTTCTTTGCTGCAGG + Intergenic
1105575910 13:21651662-21651684 TTTGTTTTGTTTTTTTCAGGCGG - Intergenic
1105612768 13:21983584-21983606 TTTGTTTTGTTTTGTTTTGCTGG + Intergenic
1105623440 13:22090565-22090587 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1105852629 13:24349368-24349390 TGTGTGTTGGTCTCTGCTGCTGG + Intergenic
1105890027 13:24676174-24676196 TTTGTTTTGTTTTTTCATCCTGG + Intergenic
1106272487 13:28167832-28167854 TTTGTTTTGTTTTTTGAAGCAGG - Intronic
1106290619 13:28357874-28357896 TTTTTTTTTTTTTTTTCTGCAGG + Intronic
1106507811 13:30386797-30386819 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1107084290 13:36409024-36409046 ATTTTGTTGTTATTTGCTGCTGG - Intergenic
1107094440 13:36519478-36519500 TTTGTTTTGTTTTTGTCTGTGGG + Intergenic
1107386884 13:39920050-39920072 TTTGAGTTGATTTTTGCTTATGG - Intergenic
1107492659 13:40896202-40896224 TTTTTTTTTTTTTTTGCTGGGGG - Intergenic
1107546370 13:41437312-41437334 TTTGTGTTAATTTTTGCACCTGG + Intergenic
1108068802 13:46606575-46606597 TTTGTTTTGTTTTTTGGGACAGG + Intronic
1108776964 13:53778116-53778138 TTTGTGTTTTTTTTAAATGCTGG - Intergenic
1108886793 13:55195721-55195743 TTTGTTTTATTTCTTTCTGCAGG + Intergenic
1109041289 13:57340721-57340743 TTTGAGTTGATTTTTGCAACTGG - Intergenic
1109241951 13:59900552-59900574 GTTTTGTTTGTTTTTGCTGCTGG - Intronic
1109264633 13:60183175-60183197 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1109586832 13:64415808-64415830 TTTTTTTTTTTTTTTGCTGGGGG + Intergenic
1109839730 13:67905866-67905888 TTTGTGTTCATTTTTGCACCTGG - Intergenic
1109847318 13:68012285-68012307 TTTGTTTGTTTTTTTGCTGGAGG - Intergenic
1109877284 13:68421976-68421998 TTTGTTTTGTTTTTTTCTTTTGG + Intergenic
1110107970 13:71703511-71703533 TTGGTATTGTTTGTTGCTGCAGG + Intronic
1110139904 13:72115631-72115653 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1110401745 13:75100069-75100091 TTTTGGTTGTTTTTTGCAACAGG - Intergenic
1110448051 13:75609659-75609681 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1110450014 13:75630657-75630679 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1110488566 13:76074978-76075000 TTTGTTTTGTTTTTTCCTGTGGG - Intergenic
1110518487 13:76445396-76445418 TTTGTTTTGTTTTTTTCTCTAGG - Intergenic
1110526187 13:76540361-76540383 TTTGAGTTGTTTTATGCTTATGG - Intergenic
1110665533 13:78113505-78113527 TTTAAGGTGTTTTTTGCTGGTGG + Intergenic
1110726196 13:78827451-78827473 TTTGGGCAGTTTTTTGCTTCAGG + Intergenic
1110871170 13:80453835-80453857 TTTTTGTTGTTTTATGCTTTTGG - Intergenic
1110947646 13:81443433-81443455 TATGTGTTGTCTTTTGATGTAGG - Intergenic
1110987813 13:81994741-81994763 TTTGTTTTGTTTTGTTATGCAGG + Intergenic
1111037169 13:82690858-82690880 TTTGTTTTGTTTTTTGATACAGG - Intergenic
1111075200 13:83226373-83226395 TTTGGTTTGGTTGTTGCTGCAGG - Intergenic
1111490004 13:88960065-88960087 TTTTTGTTTTTTTTTTTTGCTGG - Intergenic
1111546331 13:89741582-89741604 TTTTTTTTCTTTTTTGCTTCTGG + Intergenic
1111635713 13:90901238-90901260 TTTGTGTTTTTTTTTTTTTCAGG - Intergenic
1112076809 13:95922815-95922837 TTTGTTTTGTTTTTTGAGACGGG - Intronic
1112225782 13:97538572-97538594 TTTGTTTTGTTTTTTTCTCATGG - Intergenic
1112270705 13:97966567-97966589 TTTTTTTTGTTTTTGGCAGCAGG + Intronic
1112380852 13:98888223-98888245 TCTGTTTTGTTTATTGCTGCAGG - Exonic
1112525195 13:100139910-100139932 TTTGTTTTTTTTTTTCCTGTGGG + Intronic
1112535586 13:100251947-100251969 TGTTTGTTGTTTTGTGCTGATGG - Intronic
1112685669 13:101823117-101823139 TTTGTGTTGTTTTTACCTTTTGG + Intronic
1112767662 13:102762984-102763006 TTTGTGTTTTTTTTTGAGACTGG - Intergenic
1112836748 13:103524172-103524194 TTGTTGTTGTTTTCTGCTGTGGG + Intergenic
1112893433 13:104267485-104267507 TTTGTGTTTGTTTTTCCTGCTGG - Intergenic
1113153460 13:107290170-107290192 TTTTTGTTTTTTTTTTTTGCTGG - Intronic
1113230695 13:108211837-108211859 TTTGTTTTGTTTTTTGGTCAAGG - Intronic
1113519801 13:110932259-110932281 TTTGTTTTGTTTTTTTTTGATGG + Intergenic
1114050455 14:18916558-18916580 TTTGTGCTGTTTCTGGGTGCTGG + Intergenic
1114112102 14:19485374-19485396 TTTGTGCTGTTTCTGGGTGCTGG - Intergenic
1114745524 14:25142122-25142144 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1114766809 14:25381973-25381995 TTTGTTTTGTTTTTCCTTGCTGG + Intergenic
1114887331 14:26870155-26870177 TTTGTGCTGGTTCTTGATGCTGG + Intergenic
1115116066 14:29881563-29881585 TTTTTGTTTTGTTTTGCTTCTGG + Intronic
1115555206 14:34539867-34539889 TTTGTTTTGTTTTTTGGAGACGG + Intergenic
1115621990 14:35149845-35149867 TTTGTTTTGTTTTTTAAGGCGGG + Intronic
1115627581 14:35209555-35209577 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1115833279 14:37366261-37366283 TTTTTCTTCTTTTTTGCTGTAGG + Intronic
1115974617 14:38982692-38982714 TTTGTTTTGTTTTTAGCTCTAGG - Intergenic
1116066829 14:39995224-39995246 ATTCTGTTGTTTTTGGCTGAAGG + Intergenic
1116077946 14:40135918-40135940 TTTGCTTTTTTGTTTGCTGCTGG + Intergenic
1116125322 14:40776721-40776743 TTTGTTTTGTTTTGTTTTGCTGG + Intergenic
1116218646 14:42053463-42053485 TTAGTGTTGGTCTCTGCTGCTGG - Intergenic
1116222631 14:42108730-42108752 TTTGTGTCCTTTTTTACTGTTGG + Intergenic
1116314118 14:43364535-43364557 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1116481888 14:45401005-45401027 TTTGTGATGTATTGTGTTGCAGG + Intergenic
1116595219 14:46833106-46833128 TTTTTTTTTTTTTTTGCTCCTGG + Intergenic
1117041017 14:51769106-51769128 TTTGTGTTAATTTTTGCACCTGG + Intergenic
1117161098 14:52990670-52990692 TTTTTCTAGTTTTTTGCTGTAGG + Intergenic
1117429734 14:55644565-55644587 TTTTTTTTTTTTTTTGCTGTGGG + Intronic
1117779994 14:59222470-59222492 TCAGTGTTGGTCTTTGCTGCTGG + Intronic
1118033923 14:61845778-61845800 TTTTTCTTGTTTTTTGATGTAGG + Intergenic
1118040400 14:61910241-61910263 TTTGTTTTGTTTTTTGAGACGGG + Intergenic
1118089565 14:62458184-62458206 TTTGTTTTGTTTTTTGGTAGGGG - Intergenic
1118202987 14:63694476-63694498 TTTGTTTTGTTTTTTTTTCCTGG - Intronic
1118354023 14:64996773-64996795 TTTTTTTTTTTTTTTGCTTCTGG + Intronic
1118357495 14:65026854-65026876 TTTGTTTTTTTTTTTGAGGCGGG - Intronic
1118421261 14:65606702-65606724 TTTGTTTTGTTTTCTGATGGGGG + Intronic
1118506383 14:66417197-66417219 TTTCTGTTTTTTTTTTCTACTGG - Intergenic
1118864303 14:69690904-69690926 GGTGTGTGGTTTTTTGGTGCGGG - Intronic
1118874568 14:69772640-69772662 TTTTTGTTTTTTTTTGAGGCAGG + Intergenic
1118927448 14:70205747-70205769 TTTGTGTTTTTTTTTGGTTGGGG - Intergenic
1119164932 14:72484520-72484542 TTTGTGTGGTTTTTTTTTGGTGG + Intronic
1119207350 14:72804414-72804436 TTTTTGTTGTTGTTTGCTCCTGG - Intronic
1119383581 14:74243444-74243466 TTTGTTTTGTTTTTTGAAGAGGG + Intronic
1119498466 14:75101765-75101787 TTTGTGTTTTATTTTGTTTCAGG - Exonic
1119511299 14:75213655-75213677 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1119646111 14:76349718-76349740 TTTGTCTGGTTTTTCCCTGCTGG + Intronic
1119676675 14:76560884-76560906 TTTTTTTTTTTTTTTGCAGCTGG - Intergenic
1119784849 14:77305351-77305373 TTTTTGTTTTTTTAAGCTGCTGG + Intronic
1119978118 14:79048629-79048651 TTTTTTTTATTTTTTGCTGGTGG + Intronic
1120073227 14:80126277-80126299 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1120428141 14:84377400-84377422 TTTGTGTATTTTTATGCAGCTGG - Intergenic
1120452987 14:84694770-84694792 TTTACTTTGTTTTTAGCTGCAGG - Intergenic
1120464478 14:84839226-84839248 TTTGTTTTGCTTTTTGAGGCAGG + Intergenic
1120482264 14:85065214-85065236 GTTGTGATTTTTTTTGCTGGTGG - Intergenic
1120488961 14:85152117-85152139 TTTCTTTTTTTTTTGGCTGCGGG - Intergenic
1120519519 14:85510192-85510214 TTTGTTTTGTTTTTTGGAGACGG - Intergenic
1120531389 14:85636384-85636406 TTTTTTTTTTTTTTTTCTGCAGG - Exonic
1120568551 14:86089803-86089825 TTTGTTTTTTTTTTTGCAGTAGG - Intergenic
1120635247 14:86943320-86943342 TTTGTTTTGTTTTTTTTTTCTGG + Intergenic
1120760264 14:88278588-88278610 TTTCTCTTGTGTTTTCCTGCAGG - Intronic
1120962965 14:90141780-90141802 TTTGTTTTGTTTTTTGGGGGGGG + Intronic
1121040060 14:90739017-90739039 TTTTTGTTGTGTTTTGAGGCAGG - Intronic
1121136065 14:91499917-91499939 GTTGTGTTGTGTTTTGGTGGGGG - Intronic
1121599243 14:95190885-95190907 TTTGTTTTGTTTTTTGTTTGAGG - Exonic
1121604213 14:95228678-95228700 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1121649997 14:95550941-95550963 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1122085596 14:99300131-99300153 TTTGTGTTTTTTTTTCCTTGAGG + Intergenic
1122299337 14:100723110-100723132 TTTTTGTTTTTTTTTTTTGCCGG - Intergenic
1122311643 14:100800611-100800633 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1122790059 14:104180460-104180482 TCTGTTTTGTTTTTTGCTTGTGG - Intronic
1122799315 14:104221824-104221846 TCTGTGCTGTTCTATGCTGCAGG - Intergenic
1123138793 14:106055255-106055277 TTTGTTTTGTTTTTTGTAACAGG - Intergenic
1202832247 14_GL000009v2_random:48007-48029 TTTGTGTTGTTTTTTGATATAGG + Intergenic
1123677693 15:22727698-22727720 TTTGTTTTGTTTTTTGGGACAGG + Intergenic
1123737680 15:23201149-23201171 TTTGTTTTGTTTTCAGCTGAGGG + Intergenic
1124084849 15:26538625-26538647 TTTTTTTTTTTTTTTGCTTCAGG + Intergenic
1124113501 15:26816414-26816436 TTTGTGTTTTTTTTTTTTTCAGG - Intronic
1124181647 15:27481377-27481399 CTTATGTTGTTTTTTGCTTTGGG + Intronic
1124203339 15:27697114-27697136 TCTGTGTTGTTGGGTGCTGCAGG - Intergenic
1124288889 15:28429815-28429837 TTTGTTTTGTTTTCAGCTGAGGG + Intergenic
1124294334 15:28487499-28487521 TTTGTTTTGTTTTCAGCTGAGGG - Intergenic
1124329895 15:28801962-28801984 TTTGTTTTGTTTTTTGGGACAGG + Intergenic
1125196571 15:37054424-37054446 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1125292441 15:38164824-38164846 TTTGTGCTCTTTTTTTATGCTGG - Intergenic
1125565409 15:40674087-40674109 TTTTTGTTATTTTTTGATGTAGG + Intergenic
1125581905 15:40791839-40791861 TTTGTTTTGTTTTTTTCAGATGG - Intronic
1125582907 15:40799645-40799667 TTTGTGTTTGTTTCTGTTGCTGG + Intronic
1125687934 15:41574723-41574745 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1125772852 15:42183103-42183125 TTTGTTTTTTTTTTTGAGGCGGG + Intronic
1126019859 15:44389685-44389707 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1126466861 15:48968697-48968719 TTTCTGTTGCTTCTAGCTGCTGG - Intergenic
1126559860 15:50031563-50031585 TTTGGGTTTTTTTTTGTTGCAGG + Intronic
1126748595 15:51852485-51852507 TTTGTTTTGTTTTTAGCTGGGGG + Intronic
1126855718 15:52837625-52837647 TTTTTTTTTTTTTTTACTGCAGG + Intergenic
1127177751 15:56379155-56379177 TTTTTGTTCTTTTTTGTTGTAGG + Intronic
1127356275 15:58203747-58203769 ATTGTATTGTTTTTGGCAGCGGG + Intronic
1127420084 15:58796528-58796550 TTTGTTTTGTTTTTTGAAACTGG + Intronic
1128047643 15:64633151-64633173 TTTGTTTTGTTTTTTGACACAGG + Intronic
1128179476 15:65588984-65589006 TTCATGTTGTTTTTTCCTCCTGG - Intronic
1128499389 15:68217235-68217257 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1129218642 15:74117675-74117697 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1129405708 15:75315879-75315901 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1129559338 15:76550100-76550122 TTTGTTTTGTTTTTTACTGTTGG - Intronic
1129804670 15:78445788-78445810 TTTGTTTTGTTTTTTCCCTCAGG + Intronic
1129815577 15:78550335-78550357 TTTGTTTTGTTTTTTGAGACTGG + Exonic
1129896596 15:79112928-79112950 TTTGTGGGGTCTTTTGTTGCTGG + Intergenic
1130016506 15:80191330-80191352 TTTGTTTTGTTTTTTGATATGGG + Intergenic
1130075502 15:80685774-80685796 TCTGTGATGGTTTTTGCAGCAGG - Intronic
1130077377 15:80700893-80700915 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1130356031 15:83131097-83131119 TTTGTTTTGTTTTTTTGTGGTGG - Exonic
1130986578 15:88848401-88848423 TTTGTTTTTGTTTTTACTGCAGG - Intronic
1131153464 15:90061173-90061195 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1131207126 15:90459713-90459735 TTTGTTTTGTTTTTTGTTTTTGG + Intronic
1131208769 15:90475001-90475023 TTTTTTTTTTTTTTTGCTGACGG + Intronic
1131240538 15:90738555-90738577 TTTGTTTTGTTTTTTGAAACAGG - Intronic
1131241244 15:90745413-90745435 TTTTTGTTGTTTTTTGAAACAGG + Intronic
1131325534 15:91439958-91439980 TTTGTGTTGCTTTAAGCTACTGG + Intergenic
1131731855 15:95290212-95290234 TTTTTTTTTTTTTTTGCAGCAGG + Intergenic
1131766544 15:95681908-95681930 TGTTTGTTGTTTTTTGTTCCTGG + Intergenic
1131893666 15:97002430-97002452 TTTGTTTTGTTTTTTACTATGGG - Intergenic
1131924808 15:97370904-97370926 TTTCTGTTGCTTTGTGCTACAGG + Intergenic
1132008133 15:98249446-98249468 TTTGTGTTTTTTTTTGGGGGGGG + Intergenic
1132015827 15:98315762-98315784 TTTGTTTGGTTTTTTGAGGCAGG + Intergenic
1132156313 15:99498032-99498054 TTTGTTTTGTTTTCTGCTTTCGG - Intergenic
1132216243 15:100063759-100063781 TCTGTGTCGTTTGTTGCTACAGG - Intronic
1132420088 15:101658304-101658326 TTTTTTTTTTTTTTTGCTGATGG - Intronic
1132566721 16:626928-626950 TTTGTTTTGTTTTTTGAGACGGG - Intronic
1132713889 16:1281070-1281092 TTTTTTTTTTTTTTTGCAGCAGG + Intergenic
1132755744 16:1484266-1484288 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1132878164 16:2149311-2149333 TTTTTTTTTTTTTTTGCTGGGGG + Intronic
1133222856 16:4326612-4326634 TTTTTGTTGTTTTTTGAGACAGG + Intronic
1133490805 16:6265996-6266018 TTTGTGGTATTTCTTACTGCAGG + Intronic
1133506303 16:6415697-6415719 TTTGTTTTGTTTTTTGTTTGAGG - Intronic
1133691594 16:8220913-8220935 TTTATGTTGTTTTTAACTGTTGG + Intergenic
1134113635 16:11531915-11531937 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1134143815 16:11743907-11743929 TTTTGGTTGTTTTTTGATACAGG + Intergenic
1134849034 16:17465542-17465564 TTTGTGTTTTTTTTTGGGGGGGG + Intronic
1134860323 16:17554949-17554971 TTTGTTTTGTTTTTTGGAGACGG + Intergenic
1135417816 16:22282190-22282212 TTTTTGTTGTTTTTTGAGACAGG - Intronic
1135431319 16:22386137-22386159 TTTGTGATAATTTTTCCTGCAGG + Intronic
1135668323 16:24354198-24354220 TCTGTTTTGTTTTTTGCTTGAGG - Intronic
1135727895 16:24871274-24871296 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1135834649 16:25814333-25814355 TTTGTTTTGTTTTTTTTTGGCGG + Intronic
1135977645 16:27120427-27120449 TTTGTGTTGTTTTGTTTTGGGGG + Intergenic
1136090758 16:27918276-27918298 TGGTTGTTGTTTTTTTCTGCTGG - Intronic
1136157694 16:28395390-28395412 TTCATTTTGTTTTTTTCTGCTGG - Intronic
1136205393 16:28719894-28719916 TTCATTTTGTTTTTTTCTGCTGG + Intronic
1136487008 16:30579890-30579912 TTTGTTTTGTTTTTTGAGACTGG + Intronic
1136531005 16:30869212-30869234 TTTATTTTGTTTTTTGCGACAGG + Intronic
1137013356 16:35346182-35346204 TTTTTGTTTTTTTCTGCTGTGGG - Intergenic
1137254941 16:46767116-46767138 TTTTTGTTGTTTTCTGTTGTTGG + Intronic
1137263557 16:46850567-46850589 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1137423520 16:48356504-48356526 TTTTTTTTTTTTTTAGCTGCTGG - Exonic
1137687357 16:50395566-50395588 TTTGTTTTGTTTTTTTTTGGTGG + Intergenic
1137850815 16:51740573-51740595 GTTTGTTTGTTTTTTGCTGCAGG - Intergenic
1137850987 16:51742519-51742541 TTTGTTTTATTTTTTGATGTAGG - Intergenic
1138074537 16:54027990-54028012 TTTGTGTTTTTTTTTGTTTTGGG + Intronic
1138221283 16:55253025-55253047 TTTGTGTTGTTTTTGCCTTTTGG - Intergenic
1139095433 16:63699411-63699433 TTTGTTTTGTTTTTTGGAGACGG + Intergenic
1139213281 16:65101956-65101978 TTTTTGTTGTTGTTTGTTTCAGG + Intronic
1139487604 16:67267090-67267112 TTTTTTTTTTTTTTTGCTACGGG + Intronic
1139693173 16:68654404-68654426 TTTTTTTTTTTTTTTGCGGCTGG + Intronic
1139726204 16:68901085-68901107 TTTATGTTGTTTCTTCCTCCAGG + Intronic
1139748411 16:69093218-69093240 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1139836457 16:69842673-69842695 TTTGTTTTGTTTTTTGATATGGG + Intronic
1140085023 16:71787475-71787497 TTTTTGTTGTTTTTAGAGGCAGG - Intronic
1140227055 16:73086895-73086917 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1140260584 16:73375267-73375289 TTTGTGTCGTCTTTGGCTGATGG + Intergenic
1140352643 16:74277646-74277668 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1140413355 16:74755154-74755176 TTTGTGTTTTTTTTTTTGGCAGG + Intronic
1140806825 16:78540221-78540243 TTTCTGTTGCTCCTTGCTGCAGG - Intronic
1140899051 16:79351454-79351476 TTTGTTTTGTTTTTAGTGGCAGG + Intergenic
1141358181 16:83369423-83369445 TTTGTTTTGTTTTTTTGAGCTGG + Intronic
1141527572 16:84621659-84621681 TTTGTTTTGTTTTTTTCAGAGGG + Intergenic
1141559411 16:84857101-84857123 TCAGTGTTGGTCTTTGCTGCTGG + Intronic
1141646901 16:85372304-85372326 TTTGTGTTGTTTTTTAGAGATGG - Intergenic
1141948827 16:87327648-87327670 TTTTTGTTGTTTTTTGAGACAGG - Exonic
1142302235 16:89265480-89265502 TTTGTTTTTTTTTTTGCTAATGG + Intergenic
1142308089 16:89296829-89296851 TTTGTGCTGTTTTATGCTGCTGG - Intronic
1142388228 16:89780616-89780638 TTTTTTTTTTTTTTTGATGCAGG - Intronic
1142834263 17:2573203-2573225 TTTGTTTTGTTTTTTGTTTTTGG - Intergenic
1142837520 17:2598817-2598839 TTTGGATTGTTCTTTGTTGCTGG + Intronic
1143305187 17:5940977-5940999 TTTGTTTTGTTTTTTTGAGCTGG - Intronic
1143677588 17:8447146-8447168 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1143695279 17:8610423-8610445 TTTTTATTTTTTTTTGCTTCTGG - Intronic
1143826552 17:9613474-9613496 TTTGTTTTGTTTTTTGTTTTTGG + Intronic
1143949202 17:10619443-10619465 TTTGTTTTGTTTTTTGGAGATGG + Intergenic
1144005496 17:11095670-11095692 TTGTTGTTGTTTTTTGTTGTTGG - Intergenic
1144162390 17:12572581-12572603 TTTTTGTTTTGTTTTGCTTCTGG + Intergenic
1144356074 17:14447771-14447793 TTTCTGCTGTTTTCTTCTGCGGG - Intergenic
1144687226 17:17234215-17234237 TTTGTTTTTTTTTTTGCGGAAGG + Intronic
1144692500 17:17277421-17277443 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1144854358 17:18259899-18259921 TTTGTTTTGTTTTGTGCGCCAGG + Intergenic
1145825790 17:27876402-27876424 TTTGTATTTTTTTTTTCTGGAGG - Intronic
1145958916 17:28874307-28874329 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1146064927 17:29626895-29626917 TTTGTTTTGCTTTTTGATGGTGG - Exonic
1146137347 17:30334550-30334572 TTTGTTTTGTTTTTTGAGGCAGG + Intergenic
1146210022 17:30935045-30935067 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1146211311 17:30945749-30945771 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1146214159 17:30965329-30965351 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1146362546 17:32189298-32189320 TTTGTTTTGTTTTTTTCTTGAGG - Intronic
1146363836 17:32202792-32202814 TTTGAGTTTGTTTTTTCTGCAGG - Exonic
1146436358 17:32852139-32852161 TTTTTGTTGTTTTTTGAGACAGG + Intronic
1146778005 17:35639334-35639356 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1146838389 17:36131296-36131318 TTTTTTTTTTTTTTTGCTGCTGG - Intergenic
1146860658 17:36294962-36294984 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1147017771 17:37506279-37506301 TTTGTTTTCTTTTTTGCAGGGGG - Intronic
1147090987 17:38099057-38099079 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1147106225 17:38221447-38221469 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1147129030 17:38395042-38395064 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1147270564 17:39267257-39267279 TTTGTTTTGTTTTGTGGTGTGGG - Intronic
1147465000 17:40604025-40604047 TTTGTTTTGTTTTTTGAGACGGG - Intergenic
1147467837 17:40625440-40625462 TTTATCTTGTTTTTTACCGCTGG - Exonic
1147788426 17:42997127-42997149 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1147905487 17:43819950-43819972 TTTGTTTTGTTTTTTGAGTCAGG + Intronic
1148423281 17:47567072-47567094 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1148432894 17:47656838-47656860 TTTGTCTTTTTTTTTGGTGCAGG + Exonic
1148442087 17:47716651-47716673 TTTGTTTTCTTTTTTGGAGCTGG + Intergenic
1148757854 17:49983791-49983813 TTTGTTTTGTTTTTTGGAGATGG - Intergenic
1148951792 17:51319669-51319691 TTTGTTTTTTTTTTTTTTGCAGG - Intergenic
1148973552 17:51506338-51506360 TTTGTTTTGTTTTTTTCAGATGG + Intergenic
1149004202 17:51788063-51788085 TTTTTCTTCTTTTTTGATGCAGG + Intronic
1149131943 17:53313313-53313335 TTTATTTTATTTTTTGCTGTTGG - Intergenic
1149326646 17:55537427-55537449 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1149414818 17:56448272-56448294 TTTTTGTTTTTTTTTTCAGCAGG - Intronic
1149797558 17:59534503-59534525 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1149913601 17:60588102-60588124 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1150267265 17:63839561-63839583 TTTGTTTTGTTTTTTGAAGTGGG - Intronic
1150435594 17:65151936-65151958 TTTCTGTTGTTGTTTGCTGCTGG - Intronic
1150482807 17:65523509-65523531 TTTTTTTTTTTTTTTGCTGGTGG + Intergenic
1150668960 17:67172613-67172635 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1150669469 17:67179089-67179111 TTTGTTTTGTTTTTTGATATGGG - Intronic
1150715101 17:67566207-67566229 TGTTTGTTGTTTTTTGATACAGG + Intronic
1150937078 17:69648361-69648383 TTTGTTTTGTTTTTTGAGGTAGG + Intergenic
1151194877 17:72424339-72424361 TTTTTTTTTTTTTTTACTGCTGG + Intergenic
1151195349 17:72427335-72427357 TTTTTTTTTTTTTTTGCTGCTGG + Intergenic
1151303391 17:73245945-73245967 TTAGGGTTGTTTTTGGCTGGTGG + Intronic
1151317760 17:73334613-73334635 TTTGTGTTGATTTTTGTTTCTGG + Exonic
1151543771 17:74779395-74779417 CTTGTGTTGTTTTATCCTACTGG + Intronic
1151612997 17:75188957-75188979 TTTTTGTTGTTTTTTGAGGTAGG - Intergenic
1151936349 17:77264137-77264159 TTTTTGTTGTTTTTTGAGACAGG - Intergenic
1152296917 17:79472910-79472932 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1152761762 17:82111977-82111999 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1152830708 17:82495565-82495587 TTTGTTTTGTTTTTTGAGACTGG - Intergenic
1152991143 18:364987-365009 TTTGTTTTGTTTTTCACTTCTGG - Intronic
1153255266 18:3163856-3163878 TTTGTTTTGTTTTTTGAGACGGG + Intronic
1153386043 18:4498039-4498061 TTTGTGTTTTATTTTGCTGCTGG - Intergenic
1153448996 18:5205654-5205676 TTTTTGTTGTTTTATTTTGCTGG + Intergenic
1153755902 18:8282655-8282677 TTGCTGTTGTTTTTTGCGACAGG - Intronic
1153762301 18:8343401-8343423 TTTCTGTTGTGTTTTGCTGCAGG + Exonic
1153786731 18:8542124-8542146 TTTTTTTTTTTTTTTGATGCAGG - Intergenic
1153844944 18:9041077-9041099 TTTTTGTTGTTTTTTTCAGACGG - Intergenic
1154166364 18:12017592-12017614 TTTGTTTTGTTTTTTGAAACAGG + Intronic
1154193719 18:12251272-12251294 TTTTTGTTTTTTTTTGGTGGAGG - Intergenic
1154265606 18:12876139-12876161 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1154274202 18:12945731-12945753 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1154952541 18:21224398-21224420 TTTTTTTTTTTTTTTGCTGGTGG + Intergenic
1154984905 18:21540700-21540722 TTTGTTTTGTTTTTTTATGCAGG - Intronic
1155025060 18:21933833-21933855 TTTGTTTTGTTTTTTGATACAGG - Intergenic
1155031357 18:21987194-21987216 TTTGTTTTGTTTTTTGCCTATGG - Intergenic
1155101008 18:22609787-22609809 TTTGTGTTTGTTTTTGGTGTTGG - Intergenic
1155303368 18:24454635-24454657 TTTGTTTTGTTTTTTGCTTATGG + Intergenic
1155344819 18:24847857-24847879 ATTTTGTTTTCTTTTGCTGCTGG - Intergenic
1155447321 18:25925898-25925920 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1155492445 18:26413537-26413559 TTTGTTTTGTTTTTTTCTCTTGG + Intergenic
1155509203 18:26560135-26560157 TTTGTTTTTTTTTTTTCTGGTGG - Intronic
1155575134 18:27237017-27237039 TTTGTTTTTTTTTTTCCTCCAGG + Intergenic
1155828094 18:30474540-30474562 TTTGAGTAGCTTTTTGCTTCTGG - Intergenic
1155854734 18:30818855-30818877 TTTCTGTTGTTTTTTTCACCAGG - Intergenic
1155929802 18:31694813-31694835 TTTGAGTTGTTTTGTGCTCTTGG - Intergenic
1156099050 18:33571883-33571905 TTTCTATTGTTTTTTACTGGAGG - Intergenic
1156361588 18:36388741-36388763 TCTGTTTTGTTTTTTGCTTGTGG - Intronic
1156419126 18:36931758-36931780 TTTTTGTTGTTTTTTGCTTTAGG + Intronic
1156806581 18:41190134-41190156 TTTGTTTTGTTTTTTGAGTCTGG - Intergenic
1156837376 18:41570431-41570453 TTTGATTTGTTTTTTTCTCCCGG + Intergenic
1156952820 18:42923763-42923785 TTTTTTTTTTTTTTTCCTGCAGG - Exonic
1157197749 18:45633205-45633227 TTTGTGGTAGTTTTTGATGCTGG + Intronic
1157566766 18:48683727-48683749 TTGGTGTTGCTTTTCGCTGTGGG + Intronic
1157645106 18:49260852-49260874 TTTGTTTTTTTTTTTTCTCCCGG - Intronic
1157855860 18:51105155-51105177 TTTGTTTTGTTTTTTTGAGCCGG + Intergenic
1157869319 18:51215363-51215385 TTTGTCTTGTTTTTTGTTGGTGG - Intronic
1157925197 18:51756742-51756764 TTTGTTTTGTGTTTTGCTTTTGG - Intergenic
1158126603 18:54106456-54106478 TTTGTTTTGTTTTTTCCTCCAGG + Intergenic
1158237422 18:55333446-55333468 TTTGTTTTGTTTTTTTTTTCTGG - Intronic
1158275425 18:55761675-55761697 TTGTTGTTGTTGTTTGCTGGTGG + Intergenic
1158356998 18:56632292-56632314 TTTTTTTTCTTTTTTCCTGCAGG + Intronic
1158462496 18:57658662-57658684 TGTGTGTTCTTTTTTGTTGTTGG + Intronic
1158476244 18:57782239-57782261 TCTGTGTAGTTATTTGCTGCTGG - Intronic
1158630090 18:59105161-59105183 TTTGTTTTGTTTTTTACGACAGG + Intergenic
1158745053 18:60190290-60190312 TTTGTTTTGTTTTTTGCAGCTGG + Intergenic
1158764760 18:60436255-60436277 TTTGTTTTGCTTTTTGCTATTGG - Intergenic
1158779112 18:60625010-60625032 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1158918443 18:62161196-62161218 TTAGTGTTGTTTGTTGCTGATGG - Exonic
1158970197 18:62659072-62659094 TTAGTGTTGTTTTGGGCTGGGGG - Intergenic
1158972448 18:62680784-62680806 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1159452330 18:68618141-68618163 TTAATGTTGTCTTTTACTGCCGG - Intergenic
1159558973 18:69974429-69974451 TTGGTGTTGGTCTCTGCTGCTGG + Intergenic
1159615950 18:70579879-70579901 TTTGTGTTGTGTTTTTATGGTGG - Intergenic
1159822906 18:73168534-73168556 TTTGTGCTGTCTTTTTCTGCAGG - Intronic
1160092576 18:75840948-75840970 TTAGTGTTGGTCTCTGCTGCTGG - Intergenic
1160184246 18:76662228-76662250 TTTGTTTTGTTTTTTGATACAGG - Intergenic
1160186719 18:76681699-76681721 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1160365165 18:78318476-78318498 TTTGTGATGTTTTAAGGTGCTGG - Intergenic
1160763141 19:795861-795883 TTTAGGGTGTTTTCTGCTGCTGG + Intergenic
1160959700 19:1714356-1714378 TTTGTTTTGTTTTTTGTTTTTGG - Intergenic
1160963132 19:1733492-1733514 TTTTTTTTGTTTTTTGAGGCAGG - Intergenic
1161034829 19:2078762-2078784 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1161373872 19:3928937-3928959 TTTCTGTTTTTTTTTGGTGGGGG - Intergenic
1161416920 19:4152544-4152566 TTTGTTTTTTTTTTTGGTGTTGG - Intergenic
1161637880 19:5400614-5400636 TTTGTCTTGTTTTTTGAGACAGG - Intergenic
1161669635 19:5598884-5598906 TTTGTTGTGTTTTTTCCTGAAGG - Exonic
1161765648 19:6206856-6206878 TTTGTTTTGTTTTTTGAGGCGGG - Intergenic
1161824459 19:6552761-6552783 TTTGTTTTGTTTTTTGAGACGGG - Intergenic
1161970143 19:7574251-7574273 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1162073621 19:8169993-8170015 TTTGTGTTTTTTGTAGATGCTGG + Intronic
1162133253 19:8540183-8540205 TTTGGTTTGTTTTTTGAGGCAGG + Intronic
1162199998 19:9012947-9012969 TTTGTTTTGTTTTTTGGGGATGG + Intergenic
1162269355 19:9601469-9601491 TTTTTTTTTTTTTTTGATGCAGG + Intergenic
1162358169 19:10200270-10200292 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1162744976 19:12793010-12793032 TTTGTATGTTTTTTTTCTGCTGG + Exonic
1162914633 19:13867565-13867587 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1163353285 19:16793237-16793259 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1163471011 19:17497015-17497037 TTTTTGTTGTTTTTTGGTTGGGG - Intronic
1163884592 19:19954545-19954567 TTTGTTTTGTTTTTTGTTTTTGG - Intergenic
1163952906 19:20607241-20607263 TTTTTGTTGTTTCTTGCTTCTGG - Intronic
1164026044 19:21354040-21354062 TTTGTGATTTATTTTTCTGCTGG + Intergenic
1164097734 19:22026785-22026807 TTTTTTTTTTTTTTTGCTGGGGG + Intergenic
1164107606 19:22122641-22122663 TTTTTCTTGTTTCTTGCTTCTGG - Intergenic
1164257343 19:23540343-23540365 TTTGGGTGGTTTTTTGCTCTGGG - Intronic
1164387238 19:27783107-27783129 TTTGTGTTTTTTTAAGCTACTGG + Intergenic
1164588551 19:29493495-29493517 TTTGTTTTTTTTTTTCCTGAAGG - Intergenic
1164759953 19:30721210-30721232 TTTGTTTTGTTTTTTGAAACAGG + Intergenic
1164789083 19:30960736-30960758 TTTGTTTTGTTTTTTGATGGGGG - Intergenic
1165134238 19:33656539-33656561 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1165173575 19:33910433-33910455 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1165304122 19:34993164-34993186 TTTTTGTTTTTTTTTGGTGGGGG - Intergenic
1165421538 19:35724491-35724513 TTTTTCTTGTTTTTTGAGGCAGG - Intronic
1165640844 19:37384846-37384868 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1165813863 19:38629298-38629320 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1166183243 19:41123200-41123222 TTTGTTTTGTTTTTTGGAGACGG + Intronic
1166405106 19:42514929-42514951 TGTGTGTGGTGTTTTGCTGAAGG + Intronic
1166513862 19:43430881-43430903 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1166571761 19:43801493-43801515 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1166684226 19:44785928-44785950 TTTGTTTTGTTTTTTTCAGATGG - Intronic
1166729470 19:45050708-45050730 TTTGTTTTGTTTTTTGTTTTTGG + Intronic
1166929404 19:46292784-46292806 TTTGTTTTGTTTTTTAATACAGG + Intergenic
1166967748 19:46540301-46540323 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1167044959 19:47044367-47044389 TTTGTTTTGTTTTGTTTTGCAGG - Intronic
1167127656 19:47561713-47561735 TTTGTTTTTTTTTTAGCTCCAGG + Intergenic
1167196997 19:48036344-48036366 TTTGTGTTGTTGTGTGGGGCAGG + Intronic
1167518634 19:49938747-49938769 TTTTTTTTTTTTTTTTCTGCAGG + Intronic
1167659645 19:50789116-50789138 TTTTTGTTGTTTTTTGAGACAGG - Intergenic
1167941304 19:52947598-52947620 TTTGTTTTGTTTTTTTGAGCTGG - Intronic
1167987464 19:53330968-53330990 TTTGTTTTGTTTTTTTGAGCTGG + Intergenic
1168028324 19:53660168-53660190 TTTTTTTTTTTTTTTGCTGGGGG + Intergenic
1168080551 19:54007052-54007074 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1168276571 19:55281951-55281973 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1168282411 19:55312526-55312548 TTTTTTTTTTTTTTTGCCGCCGG - Exonic
1168410873 19:56139678-56139700 TTTGTTTTGTTTTTTGATACAGG - Intronic
1168458029 19:56530309-56530331 TTTGTTTTGTTTTTGGTAGCGGG + Intergenic
1168706810 19:58475044-58475066 TTTTTGTTTTTTTTTCCTTCTGG + Intronic
924968423 2:100442-100464 CTTGTCTTGTCTTTTTCTGCAGG - Intergenic
925049968 2:805715-805737 TTTGTTTTGTTGTTTTCTCCTGG - Intergenic
925258552 2:2510112-2510134 TTTCTTTTTTTTTTTGCTGTTGG - Intergenic
925593436 2:5532448-5532470 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
925672058 2:6321124-6321146 TTTGTTTTGTTTTTTGTTTTTGG - Intergenic
925791887 2:7497597-7497619 TTTCTGTTTTTTTTTGTTGTTGG + Intergenic
926107447 2:10161071-10161093 TTTGTTTTGTTTTTTGACACAGG + Intronic
926177797 2:10611915-10611937 TTTGTTTTGTTTTTTTAAGCAGG - Intronic
926189576 2:10718936-10718958 TTTGTTTTGTTTTTTGTTTTTGG + Intergenic
926492456 2:13541589-13541611 TTTGTTTTGTTTTGTTCTGAGGG + Intergenic
926774304 2:16407021-16407043 TTTGTGTTGTTTTGTTTTGGGGG - Intergenic
926998233 2:18762748-18762770 TTTGTGGTATTTTTAGTTGCAGG - Intergenic
927200639 2:20575994-20576016 TTTGTTTTGTTTTTTGAGACAGG + Intronic
927320891 2:21744584-21744606 TTTTTTTTTTTTTTTGCTGGTGG - Intergenic
927433148 2:23043932-23043954 TTTTTTTTTTTTTTTGCTGGGGG - Intergenic
927603264 2:24463052-24463074 TTTGAGTTGTGTTTGGATGCAGG + Intergenic
927608844 2:24515890-24515912 TTTGTTTTGTTTTTAACTCCTGG - Intronic
927667132 2:25040872-25040894 TTTCTTTTGTTTTTTTCTACTGG - Intergenic
927714884 2:25345176-25345198 TTGGAGTTGTTTGTTACTGCAGG - Intergenic
927785021 2:25967818-25967840 TTTGTTTTGTTTTTTGAGACAGG - Intronic
928521892 2:32097259-32097281 TTTTTGTTGTTATTTGATGTGGG + Intronic
928660743 2:33499549-33499571 TTTGTTTTGTTTTGAGATGCGGG - Intronic
928902484 2:36335304-36335326 TTTGTTTTGTTTTTTGAAACAGG + Intergenic
929163665 2:38859106-38859128 TTTGTGTTGTTTTACGTTGTGGG - Intronic
929198836 2:39213921-39213943 TTTGTTTTGTTTTTTGAGACAGG + Intronic
929389138 2:41448508-41448530 ATTGTGTTGTGTTTTTATGCTGG - Intergenic
929515525 2:42603111-42603133 TTTTTTTTTTTTTTTGCTGGGGG + Intronic
929522453 2:42666270-42666292 TTTGTTTTGTTTTTTTCAGATGG - Intronic
929634228 2:43500716-43500738 TTTTTATTGTACTTTGCTGCTGG - Intronic
929699687 2:44151225-44151247 TTAATGTTGTTTTTTTCTGATGG + Intergenic
929708959 2:44246736-44246758 TTGGTGTTGGTTTTTGCTTGTGG + Intergenic
930325146 2:49906814-49906836 TTTTTGTTGTTTTTTGAGACAGG - Intergenic
930408623 2:50995408-50995430 TTTGTATTGTTTTGTCCTGTTGG - Intronic
930445033 2:51459639-51459661 TTTGTTTTGTTTTTGGCTCTTGG + Intergenic
930481036 2:51948318-51948340 TCTGTGTTGGTCTCTGCTGCTGG + Intergenic
930526828 2:52541013-52541035 TTTGTTTTGTTTTTTTGTGATGG - Intergenic
930575098 2:53136987-53137009 TTTTTTTTTTTTTTTGCTGTAGG - Intergenic
930638485 2:53831128-53831150 TTTTTTTTTCTTTTTGCTGCAGG + Intergenic
930669801 2:54136598-54136620 TTTGTGTTGTTTCATACAGCTGG + Intronic
930909559 2:56615335-56615357 TTTGTTTTTTTTTTTGCAGAAGG + Intergenic
931303294 2:61002447-61002469 TTTGTTTTGTTTTTTGAGACAGG + Intronic
931346487 2:61451675-61451697 TTTGTTTTTTTTTTTGAGGCGGG - Intronic
931403836 2:61956755-61956777 TTTGTTTTGTTTTTTGCGATGGG + Intronic
931621320 2:64212541-64212563 TTTGTTTTGTTTTTTTTTGGGGG - Intergenic
931659470 2:64545563-64545585 TTTTTTTTTTTTTTTACTGCTGG - Intronic
931699833 2:64900510-64900532 TTTGTTTTGTTTTTTTCAGATGG + Intergenic
931837146 2:66111107-66111129 TTTTTGTTGCTGTTTTCTGCAGG - Intergenic
931902170 2:66802163-66802185 TTTTTGTTTTTTTTTGCAGGAGG - Intergenic
932186364 2:69699624-69699646 TTTGTTTTGTTTTTTGGGACAGG - Intronic
932234925 2:70113198-70113220 TTTCTTTTATTTTTTGCTACAGG - Intergenic
932348217 2:71009702-71009724 TTTGTGTTAATTTTTGCACCTGG - Intergenic
932351094 2:71032582-71032604 TTTGTGTTAATTTTTGCACCTGG - Intergenic
932637387 2:73403190-73403212 TTTGAGTTGATTTTTGCTGGTGG + Intronic
932890812 2:75596056-75596078 TTTTTTTTTTTTTTTCCTGCTGG - Intergenic
932979263 2:76644114-76644136 TCTGTTTTGTTATTTGCTGTGGG - Intergenic
932986570 2:76733078-76733100 TTTGTTTTGTTTTTTTTTCCTGG + Intergenic
933065658 2:77792315-77792337 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
933100645 2:78252229-78252251 TTTGAGTTGTGGTTTGTTGCCGG + Intergenic
933453194 2:82483825-82483847 TTTGGGTTGTTTCTTGCTTGCGG + Intergenic
933582195 2:84140086-84140108 TATGTGTTTTTTTTTGCTATTGG - Intergenic
933994538 2:87658303-87658325 TTTGAGGTTGTTTTTGCTGCAGG - Intergenic
934070387 2:88378753-88378775 TTTTTGTTGTGTTTTGTTTCTGG - Intergenic
934548067 2:95235114-95235136 TCTGTGTTGGTTATTGCTGAGGG + Intronic
934591571 2:95555960-95555982 TTTGTATTGTTTCTTCCCGCAGG + Intergenic
934628036 2:95880180-95880202 TTTGTTTTGTTTTTTGTTTTTGG - Intronic
934805370 2:97219477-97219499 TTTGTTTTGTTTTTTGTTTTTGG + Intronic
934831992 2:97536065-97536087 TTTGTTTTGTTTTTTGTTTTTGG - Intronic
935032940 2:99339542-99339564 TTTGTTTTGTTTTTTGGAGATGG + Intronic
935036962 2:99386691-99386713 TTAGGGTTGTTTTTTTCTGGGGG + Intronic
935236075 2:101139309-101139331 TTTTTGTTGTTTTTTGTTTTTGG - Intronic
935422409 2:102883446-102883468 TTTGAATTGTTTTTTGATTCAGG + Intergenic
935538514 2:104322554-104322576 TTTGTTTTGTTTTTTGTTTTTGG + Intergenic
935606551 2:104977108-104977130 TCTGTGTGGTTTTGTGTTGCTGG - Intergenic
935713722 2:105921124-105921146 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
935802948 2:106716683-106716705 TTTGGTTTGTTTTTTGGTGGGGG - Intergenic
935956472 2:108381634-108381656 TTTGTTTTGTTTTTTGAGACAGG - Intronic
935988808 2:108700550-108700572 TTTGTTTTGTTTTTTGAAACAGG - Intergenic
936023013 2:109009529-109009551 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
936023040 2:109009708-109009730 TTTGTTTTTTTTTTTTTTGCAGG + Intergenic
936111939 2:109671662-109671684 TTTTTATTGTTTTTTGTTGATGG + Intergenic
936299320 2:111292610-111292632 TTTGAGGTTGTTTTTGCTGCAGG + Intergenic
936849882 2:116883102-116883124 TTTTTTTTTTTTTTTGCTGGAGG + Intergenic
937174435 2:119914262-119914284 TTTTTTTTTTTTTTTGCTTCTGG + Intronic
937188257 2:120066965-120066987 ATTGAATTGTTTTTTGCTACTGG + Intronic
937308389 2:120886269-120886291 TTTGTTTTGTTTTTTGAGTCAGG + Intronic
937475113 2:122208413-122208435 TTTGTGCTGACTTCTGCTGCTGG + Intergenic
937487419 2:122329740-122329762 TTTGTTTTGTTGTTTTTTGCTGG - Intergenic
937542706 2:122978821-122978843 TTTGTTTTGTTTTTTGCATGTGG - Intergenic
937575240 2:123412334-123412356 TAGGTGTTGTTTTATGATGCAGG - Intergenic
937770763 2:125718417-125718439 TTTGTTTTGTTTTTTCCTCATGG + Intergenic
937785070 2:125886793-125886815 TTAGTGTTGGTCTCTGCTGCTGG + Intergenic
937841095 2:126525384-126525406 TTAGTGTTGGTCTTTGCTGCTGG + Intergenic
937874646 2:126813243-126813265 TTTGAATTGTTTATTGCTGGTGG + Intergenic
938293848 2:130164590-130164612 TTTGAGTTATTTTTTGGTGATGG - Intronic
938299063 2:130197614-130197636 TTTGTTTGGTTTTTTGAGGCAGG + Intronic
938665246 2:133528055-133528077 TTTGTTTTGTTTTTTGAGACAGG - Intronic
938666754 2:133546650-133546672 TTTGTTTTGTTTTTGCCTGCTGG - Intronic
938795142 2:134712456-134712478 TTTGTTTTTTTTTTTGATGCGGG - Intronic
938829861 2:135039573-135039595 TTTGTTTTGTTTTTTGAGACAGG - Intronic
938912722 2:135900078-135900100 TTGTTGTTGTTTTTTGTTTCTGG - Intergenic
938985775 2:136574376-136574398 TTTGAATTGTTTTTAGTTGCAGG + Intergenic
939061122 2:137422306-137422328 TTTGTTTTGTTTGTTTTTGCAGG + Intronic
939069213 2:137518821-137518843 TCAGTGTTGGTTTATGCTGCTGG - Intronic
939095055 2:137824926-137824948 TTTGTGTAGTTTTTTGCCTCAGG + Intergenic
939409173 2:141802171-141802193 TTTGCTTTCTTCTTTGCTGCTGG + Intronic
939803229 2:146738973-146738995 TTTGTTTTAGTTTTTGCTTCTGG + Intergenic
939893132 2:147760905-147760927 TGTGGGTTGTTTTTTTCTGTGGG - Intergenic
940300221 2:152169242-152169264 TTTGTTTTATTTTTTGGTGTTGG + Intronic
940321241 2:152378979-152379001 TTTTTTTTTTTTTTTGCAGCTGG - Intronic
940544250 2:155062887-155062909 TCAGTGTTGCTTTCTGCTGCTGG + Intergenic
940585675 2:155645615-155645637 TTTTTTTTTTTTTTTGCTGTGGG + Intergenic
940636472 2:156303840-156303862 TTCGTTATGTATTTTGCTGCTGG - Intergenic
940671237 2:156670861-156670883 TTTTTGTTGTTTTTGGCTGAGGG + Intergenic
940870631 2:158857224-158857246 TTTGTGTTCATTTTTGCACCTGG - Intronic
940943338 2:159588207-159588229 TTTTTTTTTTTTTTTGATGCAGG - Intronic
941405923 2:165088091-165088113 TTGTTTTTGTTTTTTGCTGTTGG - Exonic
941457789 2:165730680-165730702 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
941604638 2:167582251-167582273 TTTGAATTTTTTTTTGCTTCAGG - Intergenic
941851476 2:170187235-170187257 TTTGTTTTGTTTTTTTCAGATGG + Intronic
941932082 2:170952246-170952268 TATGTGATGTTCTTTGCTGTTGG - Intronic
942092031 2:172501439-172501461 TTTGGGTAGTTTCTTCCTGCAGG - Intronic
942112396 2:172695110-172695132 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
942157201 2:173142623-173142645 TTTGTTTTGTTTTTTTGTGGGGG - Intronic
942241585 2:173967215-173967237 TTTGTTTTGTTTTTTTTTTCAGG + Intergenic
942651296 2:178171146-178171168 TTTTTCTTGTTTTTTGATGTAGG + Intergenic
942652718 2:178185292-178185314 TTTGAGTTGATTTTTGTTTCTGG - Intergenic
943204253 2:184871411-184871433 TTTGTTTTTTTTTTTTTTGCTGG - Intronic
943241469 2:185389931-185389953 GTTGTGTTGTGTTTTCCTCCAGG - Intergenic
943300496 2:186191672-186191694 TTTGTTTTGTTTTTGGAGGCAGG - Intergenic
943508554 2:188794471-188794493 TTTGTTTTGTTTTTTTCAGATGG - Intergenic
943799534 2:192040954-192040976 TTTGTGGTATTTTTTGCAGATGG - Intronic
943934798 2:193902533-193902555 TATGTGTTATTTTTTCCTGCGGG + Intergenic
944064150 2:195601685-195601707 TTTTTTTTTTTTTTTGCTTCAGG - Intronic
944129345 2:196330136-196330158 CTTGTGTTCTATTGTGCTGCAGG + Intronic
944313984 2:198265941-198265963 TTTGTTTTGTTTTTTGAGGCAGG + Intronic
944451331 2:199845826-199845848 TTTTTTTTTTTTTTTGCTGAAGG - Intronic
944498916 2:200338028-200338050 TTTTTGTTGTTTTTTGAGACGGG + Intronic
944507241 2:200425157-200425179 TTTTTGTTGTTGTTTGTTACAGG - Intronic
944681501 2:202081549-202081571 TTTTTTTTTTTTTTTGCTGACGG + Intronic
944751310 2:202713617-202713639 TTTTTCTTGTTTTTTGATGTAGG + Intronic
945104222 2:206293973-206293995 TTTGTGTTGTTTCTAGCTTTTGG - Intronic
945378314 2:209106760-209106782 TTTTTCTTCTTTTTTGATGCAGG - Intergenic
945581415 2:211600149-211600171 TTTGTTTTGTTTTTTCCTATTGG - Intronic
945805814 2:214488590-214488612 TTTGTTTTGTTTTTTGAGACTGG - Intronic
945937847 2:215921417-215921439 TTTTTTTTGTTTTTTGTTGTTGG + Intergenic
945937850 2:215921450-215921472 TTTTTTTTGTTTTTTGTTGTTGG + Intergenic
945937852 2:215921482-215921504 TTTTTTTTGTTTTTTGTTGTTGG + Intergenic
945937859 2:215921599-215921621 TTTTTTTTGTTTTTTGTTGTTGG + Intergenic
945937860 2:215921635-215921657 TTTTTTTTGTTTTTTGTTGTTGG + Intergenic
945937864 2:215921667-215921689 TTTTTTTTGTTTTTTGTTGGTGG + Intergenic
945970840 2:216229740-216229762 TTTTTTTTTTTTTTTGCTGTTGG + Intergenic
945979160 2:216295264-216295286 TTTGTTTTGTTTTTTGAGACAGG + Intronic
946261556 2:218496312-218496334 TTTGTTTTGTTTTTTGTTGTTGG - Intronic
946440350 2:219689924-219689946 TTTGTTTTGTTTTTTGATAAGGG - Intergenic
946560906 2:220912331-220912353 TTTCTATTGTTTTTAGTTGCAGG + Intergenic
947109172 2:226699906-226699928 TTTGTTTTGTTTTTTGATGTGGG - Intergenic
947135460 2:226972922-226972944 TTTTTTTTTTTTTTTGCTACAGG - Intronic
947185168 2:227448537-227448559 TTTTTTTTTTTTTTTCCTGCAGG - Intergenic
947405160 2:229768255-229768277 TTTGTTTTGTTTTTTGAGACAGG - Intronic
947437768 2:230087611-230087633 TTTGTTTTGTTTTCTGATGCAGG - Intergenic
947507044 2:230715706-230715728 TTTGTTTTGTTTTTTGAGACAGG + Intronic
947724756 2:232390074-232390096 TTTATGTTTATTTTTGCTGTGGG - Intergenic
947995947 2:234527988-234528010 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
948071881 2:235134648-235134670 TGTGACTTGTTCTTTGCTGCAGG + Intergenic
948333542 2:237190610-237190632 TTTGTTTTGTTTTTTGAGGCAGG + Intergenic
1168779802 20:478918-478940 TTTGTTTTGTTTTTTGATACGGG - Intronic
1169096922 20:2909281-2909303 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1169097500 20:2916043-2916065 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1169624053 20:7542255-7542277 TTTTTGTTTTTTTTGGCGGCGGG - Intergenic
1169768376 20:9174137-9174159 TTTGTTTTGTTTTTTTCTCCTGG + Intronic
1170051430 20:12149726-12149748 TTTGTTTTGTTTTTGGAGGCGGG - Intergenic
1170320767 20:15095521-15095543 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1170560696 20:17555645-17555667 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1170656797 20:18294660-18294682 TTTGTTTTGTTTTTTGAAGAAGG + Intronic
1170688435 20:18589374-18589396 TTTGTTTTGTTTTTTGTTTTGGG - Intronic
1171016998 20:21550940-21550962 CTTGTGTTGTTTTTTGAGACAGG - Intergenic
1171018175 20:21560649-21560671 TTTGTGTGTTGTTTTGCTGAGGG - Intergenic
1171365900 20:24625311-24625333 TTTGTGTTGTCTTTATCTCCTGG - Intronic
1171469391 20:25357837-25357859 TTTGTGTTGTTTGTAGAGGCAGG - Intronic
1172085130 20:32375686-32375708 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1172386634 20:34538427-34538449 TTTGTTTTGTTTTTTGAGACTGG - Intronic
1172525146 20:35596235-35596257 TTTGTTTTGTTTTGTTTTGCGGG - Intergenic
1172552302 20:35810714-35810736 TTTGTTTTGTTTTTTGATTTAGG - Intronic
1172611243 20:36254171-36254193 TTTGTGTTGTTTTTACCTTCTGG - Intronic
1172659291 20:36556620-36556642 ATTTTGTTGACTTTTGCTGCAGG - Intergenic
1172760382 20:37317265-37317287 CCTGTGTTGTCTTTTGCTGAGGG + Intergenic
1172892651 20:38278027-38278049 TTTTTTTTTTTTTTTGCAGCTGG - Intronic
1173014508 20:39212801-39212823 TTTGTGTTGTTTTTACCTTTTGG + Intergenic
1173513935 20:43651648-43651670 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1173651391 20:44667427-44667449 TTGGTGTGATTTTTTGCTGAAGG + Intergenic
1173721696 20:45264218-45264240 TTTGTACTGTTTTTTTCTGAGGG - Intergenic
1173989270 20:47287822-47287844 TGTGTGTTGTTTTTTTCTAGAGG - Intronic
1174091658 20:48053571-48053593 TTTATTTTGTTTTTTTCTCCTGG - Intergenic
1174241630 20:49140387-49140409 TTTGGGTTGTTTTTACCTTCTGG - Intronic
1174251587 20:49223873-49223895 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1174315009 20:49692459-49692481 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1174536127 20:51252857-51252879 ATTGTCTTGTATTTTGCAGCAGG - Intergenic
1175584256 20:60125386-60125408 TTTATTTTATTTTTTGCTGGAGG - Intergenic
1175611462 20:60354972-60354994 TCTGTGTTGTTTTATGGTGAAGG - Intergenic
1176384301 21:6129963-6129985 TTTGAGTTGATTTTTGCCTCTGG + Intergenic
1176931059 21:14810683-14810705 TTTGAGTTGTTTTTTGCATATGG - Intergenic
1177006619 21:15680705-15680727 TTTGTTTTGTTTTTTGAGGCAGG + Intergenic
1177305168 21:19306113-19306135 ATTGTGTTGGTTTCTGCTGAAGG - Intergenic
1177352832 21:19966652-19966674 TTTGTGTTTTTTTTTTCTAAAGG + Intergenic
1177845176 21:26280615-26280637 TTTGTTTTTTTTTTTGCGGGGGG - Intergenic
1177858583 21:26426513-26426535 TTTGTTTTGTTTTTTGGGACGGG - Intergenic
1177877116 21:26646879-26646901 TTTTTTTTTTTTTTTGCTGTAGG - Intergenic
1178013705 21:28317884-28317906 CTTGTGTTTTTTTTACCTGCAGG - Intergenic
1178066893 21:28914549-28914571 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1178178331 21:30130204-30130226 TTTGTTTTGTTTTTTTCTGCAGG - Intergenic
1178303763 21:31473521-31473543 ATTTTGTTTTTTTTTGCTGTTGG + Intronic
1178427317 21:32489250-32489272 TTTGTGTTGATTTTTGCATATGG + Intronic
1178435580 21:32555082-32555104 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1178438491 21:32580108-32580130 TTTGTTTTGTTTTTTTCAGACGG + Intronic
1178443313 21:32615999-32616021 TTTGTGTTAATTTTTGCACCTGG - Intergenic
1178528926 21:33358162-33358184 TTGTTGTTGTTTTCTGCTGCTGG - Exonic
1178707125 21:34885474-34885496 TTTGTTTTGTTTTTTAGTGGGGG - Intronic
1178766207 21:35453301-35453323 TTTGTGTTTTTTTGTACTGGCGG - Intronic
1178918210 21:36721440-36721462 TTTGTTTTGTTTTTTGGAGTTGG + Intronic
1178993168 21:37372270-37372292 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1179077210 21:38133929-38133951 TTTGTTTTGTTTTTTTTTTCAGG + Intronic
1179284059 21:39961347-39961369 CTTTTGTCTTTTTTTGCTGCTGG + Intergenic
1179426333 21:41281768-41281790 TTTGTGTTCTTTGTTGCTAGTGG + Intronic
1179739171 21:43408281-43408303 TTTGAGTTGATTTTTGCCTCTGG - Intergenic
1179777903 21:43679255-43679277 TTTGGGTTTTTTTTGGCGGCGGG + Intronic
1180319824 22:11309711-11309733 TTTTTTTTTTTTTTTGCTGGGGG - Intergenic
1180361507 22:11902116-11902138 TTTGTGTTGTTTTTTGAGATAGG + Intergenic
1180411167 22:12610204-12610226 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1180468931 22:15638932-15638954 TTTGTGCTGTTTCTGGGTGCTGG + Intergenic
1180652577 22:17390642-17390664 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1181036271 22:20171249-20171271 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1181091976 22:20479688-20479710 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1181274432 22:21679593-21679615 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1181373583 22:22438228-22438250 TCAGTGTTGGTCTTTGCTGCTGG + Intergenic
1181598535 22:23934871-23934893 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1181855239 22:25776671-25776693 TTTGTGTTGTTTTTAGTTTTTGG + Intronic
1181990502 22:26833358-26833380 TTTGTTTTGTTTCTTTCTGTTGG + Intergenic
1182203908 22:28603391-28603413 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1182228840 22:28821056-28821078 TTGGTGTTTCCTTTTGCTGCAGG + Intergenic
1182334424 22:29573930-29573952 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1182426991 22:30278929-30278951 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1182901699 22:33903817-33903839 TTTGTTTTGTTTTTTGGAGATGG - Intronic
1182908808 22:33962467-33962489 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1182965839 22:34520233-34520255 TCAGTGTTGGTCTTTGCTGCTGG - Intergenic
1183199881 22:36378717-36378739 TTTTTGTTGTTTTTTGTTGGGGG - Intronic
1183242784 22:36670637-36670659 TTTGTTTTGTTTTTTGAGACTGG + Intronic
1183294320 22:37020662-37020684 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1183577643 22:38701886-38701908 TTTGTTTTGTTTTTTGGAGACGG + Intergenic
1184085530 22:42260871-42260893 CCTGGGTTGTTTTTGGCTGCAGG + Intronic
1184311254 22:43644659-43644681 TTTCTTTTCTTCTTTGCTGCTGG + Intronic
1184560540 22:45260561-45260583 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1184592945 22:45497462-45497484 TTGTTGTTGTTTTTTGTTTCAGG - Intergenic
1184867309 22:47208971-47208993 TTTGTTTTTTTTTTTCCTCCTGG + Intergenic
1185026082 22:48413910-48413932 ATGGTGATATTTTTTGCTGCTGG + Intergenic
1185240936 22:49746338-49746360 TTTGTTTTGTGTTTTGCTTTCGG + Intergenic
1185382488 22:50516428-50516450 TTTGTGTTGTTTCTTGCAGCTGG + Exonic
949457473 3:4254132-4254154 TTTGTGGTTTTTTTTGCTTTTGG - Intronic
949601013 3:5597706-5597728 TTTTTTTTTTTTTTTGCTGTGGG + Intergenic
949704276 3:6797990-6798012 TTTGTAATGTTTTTTTCTCCCGG - Intronic
949885694 3:8691804-8691826 TTTGTGTTCATTTTTGCACCTGG - Intronic
949978662 3:9484378-9484400 TTTGTTTTGTTTTTTAAGGCAGG + Intergenic
950597624 3:13998131-13998153 TTTTTCTTGTTTTTTGATGTAGG + Intronic
950667817 3:14507821-14507843 TTTGTTTTGTTTTTGGCAGCTGG - Intronic
951067863 3:18288662-18288684 TTTTTGTTGTTGTTTGCTTTAGG + Intronic
951219409 3:20053527-20053549 TTTGTCTTGTTTTTTGAGACAGG - Intronic
951520110 3:23603510-23603532 TTTGTTTTGTTTTTTGAAACAGG + Intergenic
951874918 3:27413063-27413085 TTTGTTTTGTTATTAGCTGAAGG - Intronic
952145176 3:30524597-30524619 TTTGTGTTTTTTTTTGCGGGGGG + Intergenic
952459634 3:33511000-33511022 CTTGTGTTCTTTTTTGCTGTTGG + Intronic
952800156 3:37283155-37283177 TTTGTTTTGTTTTTGGTTGTAGG - Intronic
952873002 3:37918884-37918906 TTAGTGTTTTCTTATGCTGCAGG - Intronic
952882324 3:37992554-37992576 TTTGTCTTGTTGTTTACTGTGGG - Intronic
952938462 3:38420916-38420938 TTTGAGCAGTTTTTTGCTCCGGG - Intronic
952939060 3:38426915-38426937 TTTGAGCAGTTTTTTGCTCCGGG - Intergenic
953120944 3:40041016-40041038 TTTTTTTTTTTTTTTTCTGCTGG - Intronic
953276614 3:41507171-41507193 TTTTTTTTTTTTTTTGCTCCTGG - Intronic
953437258 3:42888005-42888027 TTTGTTTTGTTTTTTTTTGATGG + Intronic
953445007 3:42955758-42955780 TTTTTTTTTTTTTTTGCTCCAGG + Intronic
953810447 3:46108162-46108184 TTTGTGTTGGTCTTTGGTCCTGG + Intergenic
953816302 3:46160754-46160776 ATTCTGTTGTTTTTTGGTGGAGG + Intergenic
953938501 3:47068806-47068828 TTTGTTTTGTTTTTTGAACCGGG + Intronic
953945452 3:47143286-47143308 TTTGTTTTGTTTTTTGAGACGGG - Intronic
953991980 3:47491093-47491115 TTTTTTTTCTTTTTTGTTGCGGG - Intergenic
954282395 3:49591601-49591623 TTTTTGTTTTTTTTTGAGGCAGG + Intronic
954547976 3:51455152-51455174 TTTGTGCTGTGTTTTGTTGTAGG - Intronic
954641452 3:52101083-52101105 TTTTTTTTTTTTTTTGCTGAGGG - Intronic
954711469 3:52507048-52507070 TTTGTTTTGTTTTTTGAGGTAGG + Intronic
954868293 3:53748203-53748225 TTCGTGTTGCTCTTTGCTTCTGG + Intronic
955080071 3:55650077-55650099 ATTGTGTTGTCTTTTGGTCCTGG + Intronic
955271058 3:57499830-57499852 TTTGTTTTGTTTTTTGAGACAGG - Intronic
955291380 3:57695308-57695330 CTTATGTTCTTTTTTGGTGCTGG - Intergenic
955291399 3:57695492-57695514 CTTATGTTCTTTTTTGGTGCTGG - Intergenic
955292519 3:57705771-57705793 TTTGTGTTGTTGTTTGAGACAGG - Intergenic
955791683 3:62594566-62594588 TTTGTTTTGTTTTTTGAGGTGGG + Intronic
955946583 3:64200460-64200482 TTTGTTTTGTTTTTTGAGACAGG + Intronic
956095447 3:65711466-65711488 TTTGTGTTTTTTTTGTCTGTAGG - Intronic
956306995 3:67836565-67836587 TCTGTGTTGGTCTCTGCTGCTGG - Intergenic
956365344 3:68495991-68496013 TTTTTTTTTTTTTTTGCTTCAGG - Intronic
956639586 3:71403094-71403116 TTTGTTTTGTTTTTTCTTTCTGG + Intronic
956665823 3:71641252-71641274 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
956698847 3:71941305-71941327 TTTTTGTTGTTTTTTGGGACAGG - Intergenic
956785537 3:72639115-72639137 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
957075081 3:75595991-75596013 TTTGTGTTAATTTTTGCACCTGG + Intergenic
957203151 3:77164159-77164181 TTTGTATTGTTTCTTGTAGCTGG + Intronic
957243645 3:77690798-77690820 TTTGTGTTGTTTTAAGGTGCTGG - Intergenic
957261130 3:77902660-77902682 TTTTTTTTTTTTTTTGCTGGGGG - Intergenic
957423881 3:80009920-80009942 TTTTTTTTTTTTTTTGCTACAGG - Intergenic
957885900 3:86287341-86287363 TTTGTTTTGTTTTTTGAGACGGG + Intergenic
957905434 3:86547759-86547781 GTTGGGTGGTTTCTTGCTGCTGG + Intergenic
957966412 3:87326899-87326921 TTTTTCTTCTTTTTTGATGCAGG - Intergenic
958049543 3:88327733-88327755 TTTTTTTTTTTTTTTGCTACAGG + Intergenic
958174873 3:89984619-89984641 TTTGTTTTGTTTTTTTCCTCAGG - Intergenic
958714360 3:97762401-97762423 TTTGTTTTGTTTTTGAGTGCAGG + Intergenic
958772126 3:98437574-98437596 TTTGTGTTTTGTTTTGCTCTAGG + Intergenic
958816629 3:98923718-98923740 TTTGTTTTGTTTTTTGAGTCAGG - Intergenic
958975131 3:100659027-100659049 TTTGTTTTGTTTTTTGGTGGTGG - Intronic
959042236 3:101435634-101435656 TTTTTCGTGTTTTTTGCTGTTGG - Intronic
959227840 3:103608571-103608593 TTTGTTTTGTTTTTTGGTCCAGG - Intergenic
959286233 3:104414895-104414917 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
959769884 3:110080952-110080974 TTTGTGTTGATTTTTGTAGATGG - Intergenic
959955046 3:112227265-112227287 TTTGTTGTGTTGTTTGCTGTTGG - Intronic
960106525 3:113803714-113803736 TTTCTGTTGTGTTTTGGTGAAGG + Intronic
960226330 3:115173824-115173846 TTTGTTTTTTTTTTTGATACAGG + Intergenic
960286212 3:115831868-115831890 TTTGTTTTGTTTTTGGCAGATGG + Intronic
960494610 3:118359822-118359844 TCAGTGTTGGTCTTTGCTGCTGG + Intergenic
960625116 3:119674623-119674645 TTTGTGTTGTTTTTTAGAGATGG - Intronic
960701096 3:120440105-120440127 TTTGTTTTGTTTTTTGACACAGG - Intronic
960865037 3:122191049-122191071 TGTGTGTTCATTTTTGCTGGTGG - Intronic
960865210 3:122192912-122192934 TGTGTGTTCATTTTTGCTGGTGG - Intronic
961007156 3:123412783-123412805 TTTGTTTTGTTTTTAGCTTGAGG - Intronic
961090704 3:124108930-124108952 TTTGGGATGCTTTTGGCTGCAGG + Intronic
961769524 3:129238758-129238780 TGTGTGTTTTTTTTTGAGGCAGG + Intergenic
961844614 3:129751192-129751214 TTTGTTTTGTTTTTTGAGACAGG - Intronic
961991088 3:131191915-131191937 TTTATGTTTTCTTTTGTTGCTGG - Intronic
962214798 3:133512012-133512034 TCAGTGTTGGTTTCTGCTGCTGG - Intergenic
962416855 3:135191067-135191089 TTTGTTTTGTTTTTTGAGACAGG - Intronic
962705504 3:138039411-138039433 TTTTTTTTTTTTTTTGCAGCTGG - Intergenic
962771675 3:138616378-138616400 TTGTTGTTGTTTTTTGCTTTTGG + Intronic
962793649 3:138833004-138833026 TTATTGTTGTTTTTTGAGGCAGG - Intronic
962955201 3:140259467-140259489 TTTGTTTTGTTTTTTGGAGATGG - Intronic
963268008 3:143258324-143258346 TTGGTGTTGGTCTCTGCTGCTGG + Intergenic
963336453 3:143979688-143979710 TTTGTGTTTTTTTTTGGTGGGGG + Intronic
963379113 3:144506349-144506371 TTAGTGTTGGTCTCTGCTGCTGG + Intergenic
963383378 3:144559376-144559398 TTTTTTTTTTTTTTTGCTGTGGG - Intergenic
963607462 3:147423455-147423477 TGCGTGTTGTTTTTTGCCGCCGG + Intronic
963706471 3:148694586-148694608 TTTGAGTTGCATTTTCCTGCTGG + Intergenic
963773739 3:149417288-149417310 TTTGTTTTGTTTTTTGCATAGGG + Intergenic
963863639 3:150336474-150336496 TTTGTTTTTGTTTTTGCGGCGGG + Intergenic
964014069 3:151925411-151925433 TTTGACTTGTATTTGGCTGCTGG - Intergenic
964128425 3:153261208-153261230 TGTGTGGTTTTTTTTGCTGTTGG - Intergenic
964245259 3:154644349-154644371 TTTGAGTTGTTTTTAGCTTTTGG + Intergenic
964360738 3:155893499-155893521 TTTGTATTGATATTTGCAGCTGG + Exonic
964453252 3:156832897-156832919 TTTGCTTTGTTTTTTGCAACAGG - Intronic
964477261 3:157108235-157108257 TTTGTTTTGTTTTATGGGGCAGG + Intergenic
964803070 3:160575264-160575286 TTTTTTTTTTTTTTTGATGCAGG - Intergenic
965107671 3:164378748-164378770 TTTGTGTTTTTTTTTCCTCCAGG - Intergenic
965371012 3:167862940-167862962 TTTGTTTTGTTTTTTACAGACGG + Intergenic
965656539 3:170990868-170990890 TTTGGTTTGTTTTTTGATACAGG - Intergenic
965797095 3:172450340-172450362 TTTGTTTTGTTTTGTTTTGCTGG + Intergenic
965975811 3:174620437-174620459 TTTGTTTTGTTTTTTTCAACTGG + Intronic
966130293 3:176629826-176629848 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
966156974 3:176927104-176927126 TTTTTTTTGTTTTTGGTTGCTGG - Intergenic
966196197 3:177316219-177316241 TTTTTTTTTTTTTTTGCTGGGGG + Intergenic
966331123 3:178815142-178815164 TTTGTTTTGTTTTTTGCAAAAGG + Intronic
966421464 3:179738838-179738860 TTTGTTTTGTTTTTGGTTGTGGG + Intronic
966618773 3:181941324-181941346 TTTTTTTTCTTTTTTTCTGCTGG - Intergenic
966709677 3:182957930-182957952 TTTTTTTTTTTTTTTGATGCAGG - Intronic
966965813 3:184991804-184991826 TTTGAGTTGTTTTTCTCTGAAGG + Intronic
967188140 3:186962739-186962761 TTTGTTTTGTTTTTGGCTAATGG - Intronic
967317966 3:188167494-188167516 TTTGTTTTGTTTTGTGGTGGTGG - Intronic
967383186 3:188883291-188883313 TTTGTGAGTTTTTTTGTTGCTGG + Exonic
967523927 3:190470538-190470560 TTTTTGTTGTTTTTTTTTGGGGG - Intergenic
967714767 3:192749885-192749907 TTGTTGTTGTTTTTTGGTGTGGG - Intronic
967716447 3:192767755-192767777 TTTGTTTTGTTTTTTAAAGCAGG - Intronic
968256338 3:197276815-197276837 TTTGTGGTGTTTTTTGGTCATGG + Intronic
1202738118 3_GL000221v1_random:27637-27659 TTTGTGTTGTTTTTTGAGATAGG + Intergenic
968393264 4:210649-210671 TTTGTTTTGTCTTTTCTTGCAGG - Intergenic
968819403 4:2838123-2838145 TGTATGTTGTTTTATTCTGCAGG - Exonic
969023371 4:4153820-4153842 TTTGTGTTAATTTTTGCACCTGG + Intergenic
969026837 4:4180143-4180165 TTTGTGTTAATTTTTGCACCTGG + Intergenic
969071505 4:4542909-4542931 TTTGTGTTGTTTTTTGAGACGGG + Intergenic
969112345 4:4851902-4851924 TTTGTTTTGTTTTGTTCTCCTGG + Intergenic
969730437 4:8953252-8953274 TTTGTGTTAATTTTTGCACCTGG - Intergenic
969786613 4:9462892-9462914 TTTGTGTTAATTTTTGCTCCTGG - Intergenic
970173891 4:13317491-13317513 TTTGAGTTGATTTTTGCTTATGG + Intergenic
970180423 4:13385847-13385869 TTTGAGTTGATTTTTGCTTATGG - Intronic
970237122 4:13969936-13969958 TTTGTTATGTTTTCTGCTGAAGG + Intergenic
970545583 4:17126985-17127007 TTTGTTTTGTTTTTTACTCTGGG + Intergenic
970744150 4:19275017-19275039 TTACGGTTGTTTTTTACTGCAGG - Intergenic
970829438 4:20319792-20319814 TTTGTTTTGTTTTTTAGTGCTGG - Intronic
970941720 4:21641873-21641895 TCAGTGTTGGTCTTTGCTGCTGG - Intronic
971542851 4:27843009-27843031 TTTGTTTTGTTTTTTGTTTTAGG - Intergenic
971876150 4:32310847-32310869 TTTTTGTTGTTTTTTCCCCCAGG + Intergenic
972217004 4:36908862-36908884 TTTTTTTTTTTTTTTGCTGTAGG - Intergenic
972563405 4:40248482-40248504 TTTGTTTTGTTTTTTGGAGATGG + Intergenic
972706046 4:41544020-41544042 TTTGTCATGTTATTTGCTGCAGG - Intronic
973341975 4:49014599-49014621 TTTGTCTTTTTTTTTGTTGTTGG + Intronic
973539747 4:51924177-51924199 TCAGTGTTGGTCTTTGCTGCTGG + Intergenic
973567876 4:52206482-52206504 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
973773470 4:54226563-54226585 TTTGTTTTGTTTTTTCCTTGAGG - Intronic
973794849 4:54414723-54414745 TTTTATTTGTTTTTTTCTGCTGG + Intergenic
973998536 4:56485393-56485415 TTTTTTTTTTTTTTTGCTGTGGG - Intronic
974102731 4:57435870-57435892 TTTCTGTTGTTTTTGCCTGAGGG + Intergenic
974375268 4:61068229-61068251 TTTTTTTTTTTTTTTGCTGTTGG - Intergenic
974471068 4:62318191-62318213 ATTGTGGTGATTTTTGCTGCAGG + Intergenic
974727531 4:65814766-65814788 TTGTTGTTGTTTTTTCCTGGTGG - Intergenic
974863373 4:67550951-67550973 TTTGTTTTGTTTTTTTCCGGAGG + Intergenic
974904693 4:68040307-68040329 TTTGTGTTTTTTTTTGAGACGGG + Intergenic
974921000 4:68238720-68238742 TTTGTTTTGTTTTTTGGAGATGG - Intronic
974992332 4:69109032-69109054 TTTTTGTTGTTTTTTTTTTCTGG + Intronic
975054587 4:69914018-69914040 TTTGTTTTGTTTTGCCCTGCAGG + Intergenic
975123667 4:70757269-70757291 TTTGTTTTGATTTTTGAGGCAGG - Intronic
975375737 4:73642941-73642963 TTTTTCTTGTTTTTTGCTGTAGG + Intergenic
975420915 4:74163875-74163897 TTTGTTTTGTTTTTTGTTTGAGG + Intronic
975546396 4:75564484-75564506 TTTTTGTTGCTTTTTTCTGAAGG - Exonic
975569357 4:75797553-75797575 TTTTTTTTTTTTTTTGCTTCTGG - Intronic
975586620 4:75956404-75956426 TTTGTTTTTTTTTTTTTTGCAGG + Intronic
975928538 4:79490130-79490152 TTTTTTTTTTTTTTTTCTGCTGG + Intergenic
976143473 4:82018005-82018027 TTTGTTTTGTTTTTTGAGACAGG + Intronic
976191686 4:82493191-82493213 TTTCTATTGTTTTTGGCTGTAGG + Intronic
976347800 4:84025413-84025435 TTTGTTTTGTTTTTATCTGGGGG + Intergenic
976495987 4:85730410-85730432 TTTGTTTTGTTTTTTGAGACAGG + Intronic
976611292 4:87033279-87033301 TTCCTGTTGCTTTTTGCTGCTGG + Intronic
976690141 4:87859981-87860003 TTTTTATTTTTTTTTTCTGCTGG - Intergenic
976992800 4:91389273-91389295 TTTGTTTTGTTTTTTGCATGTGG + Intronic
977123011 4:93128020-93128042 TTTTTTTTTTTTTTTGTTGCGGG - Intronic
977303010 4:95289391-95289413 TTCATGTTGTTATCTGCTGCTGG + Intronic
977308606 4:95356186-95356208 TTTTTTTTTTTTTTTGCTACAGG - Intronic
977337230 4:95714763-95714785 TCAGTGTTGTTCTCTGCTGCTGG + Intergenic
977364431 4:96049375-96049397 TTTTTGTTTTTTTTTGCTATTGG - Intergenic
977379220 4:96249425-96249447 CTTGTGTTGTTTTTTTTTTCTGG - Intergenic
977430899 4:96929145-96929167 TTAGTGTTGGTCTCTGCTGCTGG - Intergenic
977458405 4:97293414-97293436 TTTTTCTTGTTTTTTGATGTAGG + Intronic
977544732 4:98364045-98364067 TTTTTATTTTGTTTTGCTGCAGG + Intronic
977625109 4:99181457-99181479 TTTTTGTTGTTTTTTGAGACAGG + Intergenic
978047486 4:104149442-104149464 TTTGTGTTGTTTTAGCCTTCGGG + Intergenic
978067463 4:104422933-104422955 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
978191669 4:105920917-105920939 TTTTTGTTGTTGTTTGCTTTGGG - Intronic
978276250 4:106954294-106954316 TTTGTTTTGTTTCTTGCTTCAGG + Intronic
978553452 4:109952861-109952883 TATGTTTTCTTTCTTGCTGCTGG + Intronic
978815919 4:112905665-112905687 TTTGTTTTGTTTTTTGAGACAGG + Intronic
979091338 4:116486995-116487017 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
979092692 4:116505533-116505555 GTTGTGTGGTTTTTGGCTACTGG + Intergenic
979293712 4:119006099-119006121 TTTGTATTGTTTACTGCTGACGG - Intronic
979365085 4:119812912-119812934 TTTGTCTTGTTTTTTCCTTTGGG + Intergenic
979454879 4:120915923-120915945 GCTGTGTTATTTTTTGGTGCTGG - Intronic
979701842 4:123677325-123677347 TTTTTTTTTTTTTTTGCTACTGG - Intergenic
980074079 4:128275729-128275751 TTTTTGTTGTTTTTTGAGACAGG + Intronic
980353739 4:131718331-131718353 ATTGTCTTTTTTTTTGCTACTGG + Intergenic
980405759 4:132352855-132352877 TTAGTGTTGGTCTCTGCTGCTGG + Intergenic
980899535 4:138891440-138891462 TTTGTTTTGTTTTTTGTTTTAGG + Intergenic
980905580 4:138945421-138945443 TTTGTTTTGTTTTTTCTTGTGGG + Intergenic
981118693 4:141022220-141022242 TTTTTATTCTTTTTTCCTGCAGG + Intronic
981259298 4:142700675-142700697 TTTTTTTTATTTTTTGCAGCAGG + Intronic
981451454 4:144902659-144902681 TTTTTTTTTTTTTTTGCTGCTGG - Intergenic
981455737 4:144951663-144951685 TGTTTGTTGTTTTTTGTTGGAGG - Intergenic
981530472 4:145748495-145748517 TTTTTCTTCTTTTTTGATGCAGG + Intronic
981830250 4:148991533-148991555 TTTTTTTTTTTTTTTGCTGGGGG + Intergenic
982249556 4:153390822-153390844 TTTGTTTTGTTTTTTGAGACAGG - Intronic
982249679 4:153392078-153392100 TTTTTGTTGTTTTTTTGTGGGGG + Intronic
982320947 4:154077080-154077102 TCTGAGTTGTTTTTTGTTGTTGG - Intergenic
982585249 4:157228840-157228862 TTTGGGTTTTTTTTTGGTGGGGG - Intronic
982669056 4:158298509-158298531 TTGTTGTTGTTTTTTGCATCAGG - Intergenic
982847912 4:160275235-160275257 TCAGTGTTGGTCTTTGCTGCTGG - Intergenic
983403527 4:167296222-167296244 TTTGTTTTGTTTTTTTCAGATGG + Intergenic
983425874 4:167582630-167582652 TTTCTGGTGTTTTTTCCTTCTGG - Intergenic
983455345 4:167956008-167956030 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
983517102 4:168669392-168669414 TTTGTTTTGTTTTTTGAGACAGG - Intronic
983711004 4:170715191-170715213 TTTGTGTTGTTTTTTGATATTGG + Intergenic
984037268 4:174685000-174685022 TTTGTTTTGTTTTTTGAGACAGG - Intronic
984144022 4:176039240-176039262 TGTTTGTTGTGTTTTGTTGCTGG + Intergenic
984359217 4:178707409-178707431 TTTGTTTTGTTTTCTGCTGGAGG - Intergenic
984445336 4:179829571-179829593 TTTTTTTTTTTTTTTGCTTCAGG + Intergenic
984518465 4:180771254-180771276 TTTGTTTTGTTTTTTGATACAGG - Intergenic
984629956 4:182050797-182050819 TTTGTTTTGTTTTTTTCAGGTGG - Intergenic
984963342 4:185119556-185119578 TTTTTGTTGTTTTTTGAAACAGG + Intergenic
984967521 4:185152948-185152970 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
986036913 5:3949516-3949538 TGGGTGTTGGTTTCTGCTGCTGG + Intergenic
986069939 5:4272313-4272335 TTTGTTTTTTTTTTTTCTGATGG + Intergenic
986096634 5:4562124-4562146 TTTGTTTTGTTTTTTGTTTTTGG - Intergenic
986312503 5:6563537-6563559 TTTGTGTTGGTACTTTCTGCAGG + Intergenic
986688198 5:10292215-10292237 TTTGTTTTGTTTTTTGAGACAGG + Intronic
986803707 5:11287835-11287857 TTTGTGTAGTTTTTTGGAACTGG - Intronic
987448903 5:18056778-18056800 TTTTTTTTTTTTTTTGCTCCAGG + Intergenic
987689681 5:21251021-21251043 TTTTTGTATTTTTTTGTTGCGGG + Intergenic
987697088 5:21345624-21345646 TTTGTTTTGTTTTTTCATGAAGG + Intergenic
988258290 5:28849476-28849498 TCAGTGTTGGTTTCTGCTGCTGG - Intergenic
988493277 5:31723336-31723358 TTTGTTTTGTTTTTTTTTTCTGG + Intronic
988624229 5:32853799-32853821 TTTGTTTTGTTTTTTTTTGGAGG - Intergenic
988755152 5:34241072-34241094 TTTGTTTTGTTTTTTCATGAAGG - Intergenic
989081462 5:37626812-37626834 TTTGTGTTTTCTTTTCCTTCTGG + Intronic
989381592 5:40814196-40814218 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
989388432 5:40876192-40876214 TTTGTTTTGTTTTTTGAGGCAGG - Intergenic
990414138 5:55570083-55570105 TTTGTGTTGTTTTCTCCGGGGGG + Intergenic
990575653 5:57121105-57121127 TGTTTGTTGTTTTTTTCTCCTGG - Intergenic
990748203 5:58982654-58982676 TCAGTGTTGGTTTATGCTGCTGG + Intronic
990795129 5:59531438-59531460 TTTCTGTAGTTTTCTGCTGCTGG + Intronic
990879344 5:60521928-60521950 TTTTTTTTTTTTTTTCCTGCAGG - Intronic
990942655 5:61218830-61218852 TTTGTGTTGTTTGTTTCTGCTGG + Intergenic
991070642 5:62475815-62475837 TTTGTGTTGTATTTTACTGGTGG + Intronic
991381280 5:66030566-66030588 TTTTTTTTTTTTTTTGCGGCGGG + Intronic
991454253 5:66785223-66785245 TTTGTTTTGTTTTTTGAGACAGG - Intronic
991454693 5:66790004-66790026 TTTTTTTTTTTTTTTGCTGGTGG + Intronic
991637440 5:68720405-68720427 TTTGTTTTGTTTATTGTTTCTGG + Intergenic
991743371 5:69706756-69706778 TTTGTTTTGTTTTTTCATGAAGG - Intergenic
991754328 5:69848447-69848469 TTTGTTTTGTTTTTTCATGAAGG + Intergenic
991794944 5:70286492-70286514 TTTGTTTTGTTTTTTCATGAAGG - Intergenic
991803947 5:70405198-70405220 TTTGTTTTGTTTTTTCATGAAGG + Intergenic
991822755 5:70582067-70582089 TTTGTTTTGTTTTTTCATGAAGG - Intergenic
991833653 5:70723595-70723617 TTTGTTTTGTTTTTTCATGAAGG + Intergenic
991887318 5:71286031-71286053 TTTGTTTTGTTTTTTCATGAAGG - Intergenic
992057791 5:73009540-73009562 TTTTTGTTGTTTTTTGAGACAGG + Intronic
992062056 5:73062140-73062162 TGTGTTTTATTTTTTGCTGGTGG - Intronic
992243088 5:74790787-74790809 TTAGTGTTGGTCTGTGCTGCTGG - Intronic
992426947 5:76667626-76667648 TCTTTGTTGTTTTTTGCTCATGG + Intronic
992766431 5:80005032-80005054 TTTGTTTTGTTTTTTTTGGCTGG - Intronic
992878679 5:81083272-81083294 TTTTTTTTTTTTTTTGCTGGAGG + Intronic
992963873 5:81982441-81982463 TTTGTTTTGTTTTTTGGAGACGG - Intronic
993211669 5:84960708-84960730 TTTGGGTTGTTTTTAGTTTCTGG - Intergenic
993233143 5:85265856-85265878 TTTTTTTTTTTTTTTGCTGTGGG + Intergenic
993412445 5:87590884-87590906 TCAGTGTTGGTCTTTGCTGCTGG + Intergenic
993462600 5:88202512-88202534 TTTGTTTTGTTTTTTGATGAAGG - Intronic
993623619 5:90196424-90196446 TTTTTCTTCTTTTTTGATGCAGG - Intergenic
993722447 5:91334891-91334913 TTTGTTTTGTTTTTTGAGCCAGG + Intergenic
993726065 5:91367634-91367656 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
993780806 5:92063325-92063347 TCAGTGTTGGTTTCTGCTGCTGG - Intergenic
994079544 5:95691876-95691898 TTGGTTTTGTTTGTTTCTGCTGG + Intronic
994748980 5:103715321-103715343 TTTTTTTTTTTTTTTGCTGGGGG + Intergenic
994984279 5:106914792-106914814 TTGGTGTTGGTCTCTGCTGCTGG + Intergenic
995147118 5:108798816-108798838 TTTGTTTTGTTTTTTGAGACAGG - Intronic
995466731 5:112457410-112457432 TTTGTTTTGTTCTTAGCTCCTGG + Intergenic
995642197 5:114269495-114269517 TTTTTTTTTTTTTTTGGTGCTGG + Intergenic
995784970 5:115817899-115817921 TTGGTGATGTGTGTTGCTGCGGG + Intergenic
995918422 5:117279553-117279575 GTTTTGATGTTTTTTGCTGGTGG + Intergenic
996050760 5:118930316-118930338 TTTGTTTTGTTTTTTGCTTGTGG - Intronic
996094735 5:119386524-119386546 TTTGTTTTGTTTTGTTTTGCGGG + Intronic
996164836 5:120211581-120211603 TCAGTGTTGTTCTCTGCTGCTGG + Intergenic
996488577 5:124065751-124065773 TCAGTGTTGTTCTTGGCTGCCGG + Intergenic
996608648 5:125353181-125353203 CTTGTGTTGATTTTTGCATCAGG + Intergenic
997465934 5:134088148-134088170 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
997571667 5:134933240-134933262 TTTGTTTTGTTTTTTGAGACAGG + Intronic
997755711 5:136397517-136397539 TTTGTTTTGTTTTTAGCAGTGGG + Intergenic
997992089 5:138553035-138553057 TTTATGTTGTTTTTTGAGACAGG - Intergenic
998173833 5:139888090-139888112 TTTGTTTTGTATTTTGGTGGTGG - Intronic
998321037 5:141231449-141231471 TTTATGTTCCTTTTTTCTGCTGG - Intergenic
998651613 5:144127064-144127086 TGTGTGTGTTTTCTTGCTGCTGG - Intergenic
998661326 5:144241823-144241845 TTTGTGTTGTTTTTTCCTAGGGG - Intronic
998685954 5:144525291-144525313 TTTTTTTTTTTTTTTGCAGCTGG + Intergenic
998890201 5:146737932-146737954 TTTGTTTTGTTTTTTGAGACAGG - Intronic
998974955 5:147635563-147635585 TTTGTTTTGTTTTTTGGAGATGG + Intronic
999029201 5:148271640-148271662 TTTGTTTTGTTTTGTTCTGTTGG + Intronic
999046201 5:148472460-148472482 CTTGTCCTGTTTTTTGCTGGTGG + Intronic
999288462 5:150408047-150408069 GTTTTGTTTTTTTTTTCTGCTGG + Intronic
999504809 5:152183713-152183735 TTATTTTTTTTTTTTGCTGCTGG + Intergenic
999513415 5:152276622-152276644 TTTTTTTTTTTTTTTGCTCCTGG + Intergenic
999575817 5:152975211-152975233 TTTGTTTTGTTTTTTGATACAGG - Intergenic
999925739 5:156374629-156374651 TTTGTATTGTTTATTCATGCAGG - Intronic
1000061648 5:157662724-157662746 TTTGTGTTGGTTAATGCTGGAGG - Intronic
1000649473 5:163798551-163798573 TTTTTGTTGTTTTTTGCTTTTGG + Intergenic
1000730006 5:164822666-164822688 TTTTTTTTTTTTTTTGTTGCGGG - Intergenic
1000802271 5:165743173-165743195 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1000863443 5:166484624-166484646 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1001183345 5:169541890-169541912 TTTTTTTTTTTTTTTGCAGCAGG - Intergenic
1002119668 5:176992798-176992820 TTTGTTTTCTTTTTTGATACGGG - Intronic
1002346318 5:178549808-178549830 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1002492801 5:179591182-179591204 TTTTTGTTTTTTTTTGGTGGGGG + Intronic
1002688589 5:181035061-181035083 TTTGGGTTGTATTTTTCTACTGG + Intergenic
1003185195 6:3824336-3824358 TTGTTGTTGTTTTTTTCTGGAGG - Intergenic
1003250673 6:4426933-4426955 TTTGTGTTGCCTTTTGCACCTGG - Intergenic
1003465026 6:6370785-6370807 TTTGGGTTGTTTTTAACTTCTGG - Intergenic
1003835248 6:10064886-10064908 TTTGTTTTTGTTTTTGCAGCAGG + Intronic
1004170265 6:13290514-13290536 TTTTTGGTGGTTTCTGCTGCTGG - Intronic
1004248219 6:14000861-14000883 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1004384254 6:15158795-15158817 TTTGTTTTGTTTTTGGGGGCAGG - Intergenic
1004719339 6:18252876-18252898 TTTGCCTTGTTTGTTTCTGCTGG - Intronic
1005061955 6:21784776-21784798 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1005218334 6:23557470-23557492 TTTGTTTTATTTGTAGCTGCTGG - Intergenic
1005299800 6:24459257-24459279 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1005403611 6:25461583-25461605 TCTGTGTTGTTTTTAGTTTCTGG + Intronic
1005553774 6:26952780-26952802 TTTGTTTTGTTTTTTCATGAAGG - Intergenic
1005650566 6:27881367-27881389 TTTGTTTTGTTTTTTGAAACAGG + Intergenic
1005936959 6:30530461-30530483 GTTTTGTTGTTTTTTGGTTCTGG + Intergenic
1006012121 6:31051555-31051577 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1006062603 6:31435112-31435134 GTTGTGTTTTTTTTTCCTGGTGG - Intergenic
1006272280 6:32973455-32973477 TGTGTGGTGTTTGTTGGTGCAGG + Intronic
1006573306 6:35023282-35023304 TTTGTGCCGTCTTTTCCTGCAGG + Intronic
1006959519 6:37914350-37914372 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1007034010 6:38656062-38656084 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1007080495 6:39098672-39098694 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1007539444 6:42627501-42627523 TTTGTTTTGTTTTTTGAGTCAGG + Intronic
1007540418 6:42638034-42638056 TTTGTTTTGTTTTTTTCTGGAGG + Intronic
1007613997 6:43169996-43170018 TTTTTTTTTTTTTTTTCTGCTGG + Intergenic
1007801671 6:44399658-44399680 TTTGTTTTGTTTTTTGAGACGGG + Intronic
1007994553 6:46292435-46292457 TTTGTTTTTTTTTTTGGTGGGGG + Intronic
1008479596 6:51971735-51971757 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1008607218 6:53151991-53152013 TTTGTTTTGTTTTTTGACACAGG + Intergenic
1008996373 6:57664776-57664798 TCAGTGTTGCTTTCTGCTGCTGG - Intergenic
1009293730 6:61916975-61916997 TTTTTTTTTTTTTTTGCTGGTGG + Intronic
1009371534 6:62909388-62909410 TTTTTCTTCTTTTTTGATGCAGG - Intergenic
1009382181 6:63045432-63045454 TTTGTGTTGCTCTTTGATGTGGG - Intergenic
1009669309 6:66726330-66726352 TTTGTTTTGTTGTTTGGTGGGGG - Intergenic
1010154285 6:72774659-72774681 TTCCTATTGTTTTTTGCTGTTGG - Intronic
1010298729 6:74232393-74232415 TTTGTTTTGTTTTGTTCTGATGG + Intergenic
1010323700 6:74541426-74541448 TCAGTGTTGGTTTCTGCTGCTGG - Intergenic
1010507378 6:76676472-76676494 TTTGTTTTGTTTTTTGGAGAAGG - Intergenic
1010963884 6:82180249-82180271 TTTGTTTTGTTTTTTGAGACGGG + Intronic
1011269113 6:85558469-85558491 TTTTTGTTGTTTTTTGAGACAGG + Intronic
1011648207 6:89480778-89480800 TTTTTTTTGTTTTTTTTTGCTGG + Intronic
1011737461 6:90326294-90326316 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1011849421 6:91607368-91607390 TCTGTGTTGTTTTTTACAGTTGG + Intergenic
1012249874 6:96968351-96968373 TGTTTTTTGTTTTTTGCTGTAGG - Intronic
1012272678 6:97234063-97234085 TTTATTTTCTTTTTAGCTGCAGG - Intronic
1012461997 6:99474202-99474224 TTTTTGTTGTTTTTTGAGGTAGG + Intronic
1012511159 6:100003256-100003278 TCAGTGTTGGTTTCTGCTGCTGG + Intergenic
1012617686 6:101297252-101297274 ATTCTGCTGTTTTCTGCTGCTGG + Intergenic
1012742301 6:103033486-103033508 TTTTTTTTTTTTTTTGCTTCAGG - Intergenic
1012812994 6:103984583-103984605 TTGTTGTTGTTTTTTAATGCTGG - Intergenic
1012939074 6:105398765-105398787 TTTGTAATGATTTTTACTGCTGG - Intronic
1012977409 6:105794852-105794874 TTTTTTTTTTTTTTTGGTGCTGG + Intergenic
1012977629 6:105796920-105796942 TTAGTGTTGTTTTCTACTTCAGG - Intergenic
1013093226 6:106920372-106920394 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1013336612 6:109169219-109169241 TTTTTTTTTTTTTTTGCTGATGG - Intergenic
1013362377 6:109406041-109406063 TGTGTTTTGTTTTTTGAGGCAGG + Intronic
1013477187 6:110519495-110519517 TTGTTTTTTTTTTTTGCTGCAGG - Intergenic
1013529425 6:111005281-111005303 TTTTTGTTTTCTTTTGTTGCTGG + Intronic
1013580874 6:111533415-111533437 TTGGTTTTGTTTTTTGGTGCAGG - Intergenic
1013655872 6:112245783-112245805 TTTATGTTGTGTTTTGGTGGAGG - Intronic
1013830303 6:114264883-114264905 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1014140084 6:117931611-117931633 TTTGTTTTGTTTTTAACTGCAGG + Intronic
1014358875 6:120449654-120449676 TGTTTGTTTATTTTTGCTGCTGG - Intergenic
1014364758 6:120525400-120525422 TTTGTGTTGTTTTTGGTTTTTGG + Intergenic
1014401540 6:120996374-120996396 TTTGTTTTGTTTTTGGCGGGGGG - Intergenic
1014455853 6:121634457-121634479 TTAGTGTTGGTCTCTGCTGCTGG - Intergenic
1014631894 6:123798684-123798706 TGTGTGTTGTTTTTTTTTCCTGG - Intergenic
1014657537 6:124126941-124126963 ATTGTGTTGTTTTTTGAGACAGG - Intronic
1014664854 6:124224469-124224491 CTTGTGTTGTTTCTAGATGCTGG + Intronic
1014826667 6:126054968-126054990 TTTTTGTTGTTTTTTGAGACAGG + Intergenic
1014928725 6:127307201-127307223 TTTTTCTTGTTTTTTGATGTAGG - Intronic
1015095323 6:129408681-129408703 TCAGTGTTGGTTTCTGCTGCTGG + Intronic
1015200801 6:130578005-130578027 TTTGTTTTGTTTTTTAATGAAGG - Intergenic
1015224170 6:130837354-130837376 TTTGTTTTGTTTTTTGTTTTTGG + Intergenic
1015464557 6:133534285-133534307 TTTTTGTTGTTGTTTGTTTCAGG - Intergenic
1015475883 6:133658417-133658439 TCAGTGTTGGTTTCTGCTGCTGG - Intergenic
1015731758 6:136356170-136356192 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1016186876 6:141208078-141208100 TTTGTTTTGTTTTTTTCTGGTGG + Intergenic
1016259583 6:142151709-142151731 TTTGTTTTGTTTTGTTCTTCTGG + Intronic
1016300378 6:142623898-142623920 TTTGTTTTGTTTTTTGGAGATGG - Intergenic
1016443793 6:144112006-144112028 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1016572196 6:145526892-145526914 TTTCTATTGCTTTTTGATGCAGG + Intronic
1017018216 6:150118049-150118071 TTTGTTTTGTTTTTTGGAGACGG - Intergenic
1017118126 6:150997763-150997785 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1017234639 6:152106592-152106614 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1017291151 6:152739339-152739361 TTTGTATTTTTTTTTGCTGTAGG + Intergenic
1017323970 6:153125837-153125859 TTTGTTTTGTTTTTTGAGGCAGG - Intronic
1017546109 6:155451931-155451953 TTTCTGATGTCTTTTGATGCTGG + Intronic
1017623504 6:156324749-156324771 TTACTGTTGCTTTTTGTTGCTGG + Intergenic
1017766469 6:157611023-157611045 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1018092791 6:160359698-160359720 TTTCTGTTGTTTTTATCTCCTGG - Intronic
1018600017 6:165528436-165528458 TTAGTGTTGGTGTCTGCTGCTGG - Intronic
1018796139 6:167186965-167186987 TTTCTGTTGTTTGGAGCTGCTGG + Intronic
1018820182 6:167368092-167368114 TTTCTGTTGTTTGGAGCTGCTGG - Intronic
1019166976 6:170103533-170103555 TTTGTTTTGCTTTTTGCCGTTGG - Intergenic
1019605556 7:1908385-1908407 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1019673649 7:2297543-2297565 TTTTTTTTTTTTTTTGCGGCGGG - Intronic
1020064843 7:5179910-5179932 TTGTTGTTGCTTGTTGCTGCTGG + Intergenic
1020169390 7:5833295-5833317 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1020190957 7:5997548-5997570 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1020310474 7:6863994-6864016 TTTGTGTTAATTTTTGCACCTGG + Intergenic
1020385540 7:7597702-7597724 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1020814210 7:12884722-12884744 TCTGTGTTGTGTTTTTCTGAAGG - Intergenic
1021121585 7:16801696-16801718 TTTGTGTCCTTTTTGGCTCCAGG + Exonic
1021182752 7:17527397-17527419 TTTTAGTTATTTTGTGCTGCTGG + Intergenic
1021753826 7:23831975-23831997 TTGGTGTTTTTTTTTGTTGAGGG + Intronic
1021760886 7:23902487-23902509 TATGTATTCTTTTTTGCTGTTGG + Intergenic
1021856087 7:24857795-24857817 TTTGTGTTGTTTTTTGCTGCAGG + Intronic
1022062196 7:26808781-26808803 TTTGAGTTGATTTTTGCCGTAGG - Intronic
1022159840 7:27698617-27698639 TTTGTTTTGTTTTTTGAGACTGG - Intergenic
1022510275 7:30930935-30930957 CTGATGTTGTTTTTTCCTGCTGG + Intergenic
1022583649 7:31583622-31583644 TTTGTTTTGTTTTTTTCAGATGG - Intronic
1022689085 7:32628289-32628311 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1023409721 7:39877745-39877767 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1023457235 7:40353632-40353654 ATGGTGTTATTTTTTGCTGATGG + Intronic
1023476576 7:40585683-40585705 TTTGTTTTGTTTTTTGAGACGGG + Intronic
1023766243 7:43513684-43513706 TTTTTTTTGTTTTTTGCTTTTGG + Intronic
1024085337 7:45887929-45887951 TTTTTGTTTTGTTTTGTTGCAGG + Intergenic
1024425205 7:49216805-49216827 TTTTGTTTGTGTTTTGCTGCAGG + Intergenic
1024491578 7:49991544-49991566 ATTGTTTTGCTTTTTGCTTCAGG - Intronic
1024572680 7:50736871-50736893 TTTGAGTTGCTTTTTGCTTATGG - Intronic
1024860217 7:53830804-53830826 TTTGTGGTTTATTTTGCTGCAGG - Intergenic
1024884222 7:54123711-54123733 TCAGTGTTGTTCTCTGCTGCTGG + Intergenic
1025002891 7:55332245-55332267 CTGGTGTTGATTTTTTCTGCTGG + Intergenic
1025043147 7:55665814-55665836 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1025063460 7:55831736-55831758 TTTGTGTTCTTTTTAGATTCTGG - Intronic
1025125292 7:56339509-56339531 TTTGTTTTGTTTTTTGAGACGGG + Intergenic
1025136069 7:56414348-56414370 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1025239386 7:57258402-57258424 TTTGTTTTGTTTTTTAATGTAGG - Intergenic
1025770175 7:64497707-64497729 TTTGTTTTGTTTTTTAGTGTAGG - Intergenic
1026066421 7:67077586-67077608 TTTGTGGGTTTTTTTGCTGTTGG + Intronic
1026073526 7:67144474-67144496 TTTGTTTTGTTTTTTTGAGCTGG + Intronic
1026091465 7:67303963-67303985 TTTTTGTTGTTTTTTTCAGACGG + Intergenic
1026265049 7:68788895-68788917 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1026321928 7:69275793-69275815 TTTTTTTTTTTTTTTGCTGGGGG - Intergenic
1026395208 7:69945623-69945645 TTTGGGTTTTTTTTTGGTGATGG + Intronic
1026581905 7:71625539-71625561 TTTTTGGTGTTTTTTGTTGGGGG + Intronic
1026655678 7:72254638-72254660 TTTTTATTTTTTTTTGCTGAGGG + Intronic
1026703359 7:72667706-72667728 TTTGTTTTGTTTTTTTGAGCTGG - Intronic
1026710505 7:72734753-72734775 TTTGTGGGTTTTTTTGCTGTTGG - Intronic
1026744904 7:73004194-73004216 TTTGTTTTGTTTTTTTCAGACGG - Intergenic
1027019794 7:74803772-74803794 TTTGTGTTTTGTTTTGAGGCAGG - Intronic
1027068232 7:75142169-75142191 TTTGTGTTTTGTTTTGAGGCAGG + Intronic
1027098836 7:75360888-75360910 TTTGTTTTGTTTTTTTCAGACGG + Intergenic
1027370464 7:77504485-77504507 TTTGTGTTTTTATTTGCTACAGG - Intergenic
1027521254 7:79211463-79211485 TTTGTTTTTTTTTTTGAGGCAGG + Intronic
1027527032 7:79282452-79282474 TTTTTGTTGTTGTTTTCTGCAGG + Intronic
1027601698 7:80247758-80247780 TTTGTTTTGTTTTTAGTTGTGGG + Intergenic
1027614849 7:80409183-80409205 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1027640994 7:80733772-80733794 TTGGTGTTCTTTTTTCCTTCTGG + Intergenic
1027644550 7:80780876-80780898 TTTGTGTTGTTTTATGAGACAGG - Intronic
1028043975 7:86092396-86092418 TCTGTGTTGGTCTCTGCTGCTGG - Intergenic
1028417382 7:90595609-90595631 TTTTTGTTGTTGTTTGCGGTGGG - Intronic
1028420449 7:90626931-90626953 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1028475216 7:91245841-91245863 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1028543243 7:91968875-91968897 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1028543974 7:91977252-91977274 CTTGTGTTGTTTTTTGAGACAGG - Intronic
1028564576 7:92215473-92215495 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1028839251 7:95409305-95409327 TTTGTTTTGTTTTTTGGAGATGG - Intronic
1028848236 7:95507143-95507165 TTTGTTTGTTTTTTTGCTGCAGG + Intronic
1029077183 7:97944333-97944355 TTTGTGTTAATTTTTGCACCTGG + Intergenic
1029818936 7:103126610-103126632 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1029821978 7:103155464-103155486 TTTTTTTTTTTTTTTGCTGTAGG - Intergenic
1029955734 7:104637540-104637562 CTTGTGTTGATTTTTGCTTATGG + Intronic
1030227714 7:107170150-107170172 TTTGTTTTGTTTTTGGCTCATGG + Intronic
1030290809 7:107870959-107870981 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1030306369 7:108022816-108022838 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1030437805 7:109547322-109547344 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1030828578 7:114191809-114191831 TTTGTGTTGTTTTTTTCCGCGGG + Intronic
1030852378 7:114506025-114506047 TTTTTGTTGTTTTTTAATGTGGG - Intronic
1030881083 7:114881038-114881060 TTTGTTTTGTTTTTTTATCCTGG + Intergenic
1030922705 7:115412009-115412031 TTTGTACTGTTTTCTGCTACTGG - Intergenic
1031145390 7:117992043-117992065 TTTTTGTTGTCTTTTGCTTCAGG + Intergenic
1031359709 7:120834436-120834458 TTTCTGTTGCTTTTTGATGAGGG + Intronic
1031428801 7:121639808-121639830 TTTGTGTTATATTTTCCTGATGG + Intergenic
1031552123 7:123127852-123127874 TTTTTTTTTTTTTTTGCTGGGGG + Intronic
1031788302 7:126063684-126063706 TTTGTTTTCATTTTTGCTGTTGG - Intergenic
1031826846 7:126576286-126576308 TTTGTTTTGTTTTTTGAGGCAGG + Intronic
1031940599 7:127784922-127784944 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1032132708 7:129243996-129244018 TTTGTGCTTTTTTTTGGTGGGGG + Intronic
1032251204 7:130259463-130259485 TTGGTTTTGTTTTTTTCTGTTGG + Intergenic
1032309549 7:130771588-130771610 TTTGTTTTGTTTTTTGAGACTGG + Intergenic
1032522357 7:132555038-132555060 TTTGTTTTTTTTTTTCCTTCAGG - Intronic
1032607226 7:133368797-133368819 TGTGTGTTATTTTTTTCTGAAGG + Intronic
1032830785 7:135623275-135623297 TTTATTTTATTTTTTGCAGCAGG - Intronic
1032863896 7:135906705-135906727 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1032954114 7:136950639-136950661 TTTTTGTTGTTTTTAGCTTGAGG - Intronic
1033017822 7:137690002-137690024 TTTGTTTTTCTTCTTGCTGCAGG - Exonic
1033318772 7:140320823-140320845 TTTGTGTTATTTTTTGCATATGG - Intronic
1033327258 7:140390081-140390103 TTTGTTTTGTTTTTTGAGGCAGG - Intronic
1033439838 7:141368629-141368651 TTTGTGTTGATTTTTCCCGATGG + Intronic
1033604287 7:142914497-142914519 TTTGTTTTGTTTTTTCCTGTTGG - Intronic
1033680770 7:143594376-143594398 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1033704122 7:143867437-143867459 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1034288065 7:149903882-149903904 TTGTTGTTGTTTGTTGTTGCTGG + Intergenic
1034407989 7:150918627-150918649 TTTGTTTTGTTTTTTGTTTTAGG + Intergenic
1034519535 7:151608725-151608747 TTTGTTTTGTTTTTTTATACTGG - Intronic
1035096779 7:156362224-156362246 TTTGTGGTGGTTTTGGCTGGAGG - Intergenic
1035548095 8:499237-499259 TTTGTTTTGTTTTTGGAGGCAGG + Intronic
1036202868 8:6784033-6784055 TCTGTGTTCTGTTTTGCTCCTGG - Intergenic
1036240603 8:7077614-7077636 TTTGTGTTAATTTTTGCACCTGG - Intergenic
1036261454 8:7243963-7243985 TTTGTGTTAATTTTTGCCCCTGG + Intergenic
1036305145 8:7595593-7595615 TTTGTGTTAATTTTTGCCCCTGG - Intergenic
1036313494 8:7702507-7702529 TTTGTGTTAATTTTTGCCCCTGG + Intergenic
1036355995 8:8043589-8043611 TTTGTGTTAATTTTTGCACCTGG - Intergenic
1036422265 8:8608657-8608679 TTTGTTTTGTTTTTTTTTTCAGG + Intergenic
1036495643 8:9267828-9267850 TTTGTTTTGTTTTTTGAGACTGG + Intergenic
1036565934 8:9938097-9938119 TTTCTGTTGTCTCTGGCTGCCGG - Intergenic
1036623885 8:10448758-10448780 TGTGTCTTTTTTTTTGCTTCTGG - Intergenic
1036726513 8:11225498-11225520 TTTGTTTTGTTCTTTGCTTAAGG - Intergenic
1036819171 8:11925875-11925897 TTTGTGTTAATTTTTGCACCTGG + Intergenic
1036857393 8:12308825-12308847 TTTTTTTTTTTTTTTGCTGTGGG - Intergenic
1036902559 8:12681736-12681758 TTTGTGTTAATTTTTGCACCTGG + Intergenic
1036911155 8:12758225-12758247 TTTTTTTTTTTTTTTGCTGTGGG + Intergenic
1037228404 8:16623544-16623566 TTTGCCTTCTTTTTTGTTGCAGG - Intergenic
1037246682 8:16843352-16843374 TATGTTTTGTTTTTTCCTGCTGG - Intergenic
1037268349 8:17095184-17095206 GTTCTGTTGTTTGTTTCTGCTGG + Intronic
1037279382 8:17219772-17219794 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1037548527 8:19947625-19947647 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1037746023 8:21645071-21645093 TTTTTTTTTTTTTTTGCTGTAGG - Intergenic
1037900869 8:22688564-22688586 TTTGTTTTGATTTTTGGTGGTGG - Exonic
1038134507 8:24770757-24770779 TTTGTGTTGTTTGTGGCTAGTGG - Intergenic
1038184921 8:25264366-25264388 TTTTTGTTGTTTTTTTCTTGTGG - Intronic
1038635002 8:29278951-29278973 ATGTTGTTGTTTTTTGTTGCTGG - Intergenic
1038764813 8:30417070-30417092 CTTGTTTTGTTTTTTGTTGGGGG + Intronic
1038816099 8:30905896-30905918 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1038987250 8:32825248-32825270 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1039051323 8:33497331-33497353 TTTTTTTTTTTTTTTGCTGCAGG - Intronic
1039109766 8:34028915-34028937 TTGGTTTTGTTTTTTTCTGGGGG - Intergenic
1039120556 8:34141814-34141836 TTTGTTTTGTTTTTTGAGTCAGG + Intergenic
1039181158 8:34868197-34868219 TTTGTGTTGTGTTTTCTTTCTGG + Intergenic
1039261176 8:35773721-35773743 TTTGTTTTGTTTTTTGTTTGAGG + Intronic
1039304610 8:36248038-36248060 TTTGTGTTTTTTTTTGAGACAGG - Intergenic
1039307969 8:36284393-36284415 TTTTTCATGTTGTTTGCTGCTGG + Intergenic
1039591349 8:38752509-38752531 TTTTTGTTGTTTTTTGGTTTTGG - Intronic
1039605770 8:38879005-38879027 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1039818454 8:41115379-41115401 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1040045712 8:42961790-42961812 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1040420689 8:47237905-47237927 TTTTTGTTGTTTTTTGGTTTTGG + Intergenic
1040659459 8:49553591-49553613 TTTTTTTTTTTTTTTTCTGCAGG + Intronic
1041022000 8:53647669-53647691 TTTGTTTTGTTTTTTGGAGAGGG + Intergenic
1041045733 8:53884199-53884221 TTTTTTTTTTTTTTTGATGCTGG + Intronic
1041101310 8:54398838-54398860 TTTGTTTTTTTTTTGGCGGCGGG - Intergenic
1041106127 8:54445771-54445793 TTTGTTTTGTTTTTTGAGGCAGG + Intergenic
1041200001 8:55444168-55444190 TTTGTTTTGTTTTTTGTTTTTGG - Intronic
1041339605 8:56830038-56830060 TTTGTGTTATTTTTTGTGGAAGG - Intergenic
1041399114 8:57422289-57422311 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1041416135 8:57610216-57610238 TTTGTTTTGTTTTGTTTTGCTGG + Intergenic
1041577999 8:59421779-59421801 TTTGTATTGGTTTTTGTTTCTGG - Intergenic
1041679781 8:60577049-60577071 TTTTTCTTGTTTTTTGAGGCAGG + Intronic
1041740686 8:61153519-61153541 TTTGTTTTGTTTTTGGCATCTGG + Intronic
1041764645 8:61405708-61405730 TTTTTTTTTTTTTTTGCTCCTGG + Intronic
1041909067 8:63068653-63068675 TTTGTTTTGTTTTTAGTGGCTGG + Intronic
1041963563 8:63648351-63648373 TTTGTTGTGTTGTTTCCTGCAGG + Intergenic
1041986315 8:63925404-63925426 TCAGTGTTGGTCTTTGCTGCTGG - Intergenic
1042245904 8:66708582-66708604 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1042341295 8:67682880-67682902 TTTTTGGTGATTCTTGCTGCAGG + Intronic
1042376042 8:68054357-68054379 TTTGTTTTGTTTTTTTCTCTTGG - Intronic
1042479925 8:69291460-69291482 TTTTTTTTTTTTTTTGCAGCAGG - Intergenic
1042564617 8:70099491-70099513 TTTGTGTAGTTTTTGACTGGAGG + Intergenic
1042882905 8:73513911-73513933 TTTGTGGTGTTTCTGCCTGCGGG - Intronic
1043030217 8:75124933-75124955 TTTTTGTTGTTGTTTTCTGGGGG - Intergenic
1043049904 8:75372589-75372611 TTTGTTTAGTTTTTTTCTCCAGG - Intergenic
1043317619 8:78940969-78940991 TCAGTGTTGGTCTTTGCTGCTGG + Intergenic
1043336807 8:79186150-79186172 TTTTTGTTGGTTTCTGCTGCTGG + Intergenic
1043341033 8:79239956-79239978 TTTTTTTTTTTTTTTCCTGCTGG - Intergenic
1043576867 8:81668586-81668608 TTTGTTTTGTTTTTTGGAGATGG - Intronic
1043648509 8:82556215-82556237 TTTGTTTTTTTTTTTTCAGCTGG - Intergenic
1043768077 8:84162775-84162797 TTGTTGTTGTTTTTTGTTGTTGG + Intergenic
1043794550 8:84520110-84520132 TTTTTGTTTTGTTTTACTGCGGG - Intronic
1043796159 8:84543259-84543281 TTTTTATTGTTTTTTTTTGCTGG + Intronic
1043879425 8:85524833-85524855 TTTGAGTTGTTTTCTGTTGTGGG - Intergenic
1043914201 8:85901980-85902002 TTTGTCTTATTTTTTGCGTCAGG - Intergenic
1044059247 8:87614108-87614130 TGTGTGTTGTTTTTTGAGACAGG - Intronic
1044066056 8:87701530-87701552 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1044104525 8:88186595-88186617 TTTTTTTTTTTTTTTGCAGCTGG - Exonic
1044364939 8:91333890-91333912 TCTGTGTTCTTGTTTGCTTCTGG + Intronic
1044653159 8:94520178-94520200 TTTTTTTTTTTTTTTGATGCAGG - Intronic
1044715903 8:95099232-95099254 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1044736061 8:95279421-95279443 TCTTTCTTGTTTTTTACTGCAGG + Intergenic
1044754033 8:95443417-95443439 TTTGTTTTGTTTTGTCCTGGCGG - Intergenic
1044938730 8:97318921-97318943 TTTGTGTTATTTTGTGCGACTGG + Intergenic
1045048180 8:98298754-98298776 TTTGTTTTGTTTTTTGTGGCAGG - Intergenic
1045122659 8:99055041-99055063 TTTGTTTTTTTTTTTGTTACAGG + Intronic
1045240977 8:100401438-100401460 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1045418304 8:101988896-101988918 TTTTTTTTTTTTTTTTCTGCTGG - Intronic
1045469324 8:102497162-102497184 TTTGTTTTGTTTTGTTTTGCTGG - Intergenic
1045590930 8:103596390-103596412 TTTTTGTTGTTTTTTGGTAGAGG + Intronic
1045620123 8:103967496-103967518 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1045718144 8:105073149-105073171 TTTTTTTTTTTTTTTGCTGCAGG - Intronic
1045900528 8:107273953-107273975 TTTGTTTTGTTTTTTGATCAAGG - Intronic
1046292161 8:112177300-112177322 TTTGTGTTGTTGTTTTTTCCTGG + Intergenic
1046294924 8:112205185-112205207 TTTGAGTTGATTTTTGTAGCTGG - Intergenic
1046354845 8:113069105-113069127 TTTGTGTGGTTTTTTTTGGCAGG - Intronic
1046384892 8:113496375-113496397 TCTGTTTTATTCTTTGCTGCTGG - Intergenic
1046583527 8:116123039-116123061 TCTGTTTTGTTTTTTTTTGCGGG + Intergenic
1046663211 8:116971296-116971318 TTTGTTTTTTTTTTTCCTACAGG - Intronic
1047148735 8:122236499-122236521 TTTGTTTTGTTTTTTAATGAGGG + Intergenic
1047755396 8:127914253-127914275 TTTTTTTTTTTTTTTGCTGTTGG - Intergenic
1048418683 8:134255180-134255202 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1048433151 8:134389637-134389659 GTTGTTTTGTTTTTGGCTGTGGG - Intergenic
1048472036 8:134712624-134712646 TTTTTTTTTTTTTTTGCGGCGGG + Intronic
1048635329 8:136289243-136289265 TTTGGTTTGTTTTTGGCTGGTGG - Intergenic
1048776907 8:137956814-137956836 TTTTTTTTTTTTTTTTCTGCTGG + Intergenic
1049084709 8:140469835-140469857 TTTGTGTTGTTTTTTTGAGATGG + Intergenic
1049091858 8:140521354-140521376 TTTGGGAGGCTTTTTGCTGCAGG - Intergenic
1049108965 8:140631051-140631073 TTTGTTTTGTTTGTTTCTGAGGG - Intronic
1049919933 9:353778-353800 TTTATTTTGTTTTTATCTGCAGG + Intronic
1050185587 9:2969441-2969463 TTTTTTTTTTTTTTTGCTGTAGG + Intergenic
1050221394 9:3394454-3394476 TTTGTTTTGTTTTTTGAGACGGG - Intronic
1050427307 9:5524629-5524651 TTTTTGTTGTTTTCTTTTGCAGG - Intronic
1050898033 9:10909067-10909089 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1051046056 9:12874884-12874906 GTTGTTTTGTTTTTTGAGGCAGG + Intergenic
1052908221 9:33856044-33856066 TTTGTTTGGTTTTTTGAGGCAGG - Intronic
1052932829 9:34069523-34069545 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1052973192 9:34392076-34392098 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1053123975 9:35564755-35564777 TTTGTTTTGTTTTTTGAGGTGGG - Intergenic
1053163935 9:35831507-35831529 TCTGTGTTGATTACTGCTGCTGG + Intronic
1053627061 9:39884931-39884953 ATTATCTTTTTTTTTGCTGCTGG + Intergenic
1053672736 9:40385110-40385132 TTTGAGTTGATTTTTGCAGAAGG - Intergenic
1053778930 9:41581089-41581111 ATTATCTTTTTTTTTGCTGCTGG - Intergenic
1053832551 9:42098599-42098621 TATCTGTTTTTTTTTGCTGTTGG - Intronic
1053922551 9:43011498-43011520 TTTGAGTTGATTTTTGCAGAAGG - Intergenic
1054166890 9:61791329-61791351 ATTATCTTTTTTTTTGCTGCTGG - Intergenic
1054216826 9:62365772-62365794 ATTATCTTTTTTTTTGCTGCTGG - Intergenic
1054356187 9:64066071-64066093 TTTGTTTTGTTTTTTTTGGCGGG - Intergenic
1054383847 9:64525172-64525194 TTTGAGTTGATTTTTGCAGAAGG - Intergenic
1054511889 9:65991173-65991195 TTTGAGTTGATTTTTGCAGAAGG + Intergenic
1054670656 9:67789569-67789591 ATTATCTTTTTTTTTGCTGCTGG + Intergenic
1054776639 9:69129502-69129524 TTTTTTTTGTTTTTTGCGACAGG - Intronic
1054806143 9:69397312-69397334 TTTGTTTTGTTTTTTGGTGTTGG - Intergenic
1054844408 9:69777799-69777821 TTTATGTTTTTCTTTGCTGTTGG + Intergenic
1054950381 9:70844463-70844485 GTTTTGTTGTTTTTTGGTTCGGG - Intronic
1055032234 9:71782228-71782250 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1055077568 9:72231721-72231743 TTTGTTTTGTTTTGTTCTTCTGG + Intronic
1055329363 9:75167486-75167508 TTTGTTTTGTTTTTAGTTCCTGG - Intergenic
1055402914 9:75943384-75943406 TTTGAGTTTTTTGTTGTTGCTGG - Intronic
1055495322 9:76848898-76848920 TCTGTTTTGTTTTTTGAGGCAGG + Intronic
1055726125 9:79231129-79231151 TTTGTTTTTTTTTTTCCTTCTGG - Intergenic
1055769929 9:79706048-79706070 TTGTTGTTGTTTTTTGAGGCAGG + Intronic
1056008513 9:82301286-82301308 TTTTTGTTGTTGTCTGCTACTGG + Intergenic
1056060059 9:82876210-82876232 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1056141629 9:83686384-83686406 TTTGTTTTGTTTTTAGAGGCGGG - Intronic
1056151530 9:83794981-83795003 TTTGTATTGTTTTTTAGTGGAGG - Intronic
1056257100 9:84811272-84811294 TTTGTTTTGTTTTGTTTTGCTGG - Intronic
1056279231 9:85023780-85023802 CCTGTGTTGGTTTTTGCTGATGG - Exonic
1056472379 9:86918450-86918472 TTTGTTTTGTTTTTTGTTTTTGG - Intergenic
1056602842 9:88059894-88059916 TTTTTTTTTTTTTTTGATGCAGG - Intergenic
1056863700 9:90210889-90210911 TTTGTGTTAATTTTTGCACCTGG - Intergenic
1056903132 9:90619931-90619953 TATGTGTGGTCTTTTGCTACTGG - Intronic
1056916210 9:90748555-90748577 TTTGTGTTAATTTTTGCACCTGG + Intergenic
1056930841 9:90875395-90875417 TTTGTTTTGTTTTTTGAAACAGG - Intronic
1057007583 9:91574133-91574155 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1057532363 9:95861944-95861966 CTTTTGTTGTTTTTGGCTGGAGG + Intergenic
1057591682 9:96378420-96378442 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1057887588 9:98842187-98842209 TTTGTATTGTTTTTTGAGACAGG + Intronic
1057992085 9:99781216-99781238 TTTGTGTTGTCTTAAGCTACTGG - Intergenic
1058107657 9:100991071-100991093 TTTGTTTTGTTTTGTTTTGCAGG - Intergenic
1058391969 9:104505815-104505837 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1058506792 9:105674414-105674436 TTTTTTTTCTTTTTTGCTGAAGG + Intergenic
1058548255 9:106084696-106084718 TTTGAGTTAGTTTTTGCTGGAGG + Intergenic
1058826109 9:108777387-108777409 TTGCTTTTGTTTTTTGCTGGAGG + Intergenic
1058859644 9:109103303-109103325 TTTGGATGGTTTATTGCTGCTGG - Intronic
1058955638 9:109944677-109944699 ATTGTTTTGTTTTTAGCTTCTGG + Intronic
1059047731 9:110888559-110888581 TTTTTTTTTTTTTTTTCTGCTGG - Intronic
1059050650 9:110921126-110921148 TTTGTTTTGTTTTTTGAAACAGG - Intronic
1059152678 9:111963538-111963560 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1059218931 9:112593582-112593604 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1059703331 9:116796815-116796837 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1059799780 9:117738470-117738492 TTTGCATTTTTTTTTTCTGCAGG - Intergenic
1059916507 9:119108896-119108918 TTTGTATTATTTTTGGCTGTTGG + Intergenic
1059941372 9:119363103-119363125 TTTGTTTTGTTTTTTGAAACAGG + Intronic
1060288463 9:122276872-122276894 TTTTTGTTGTTTTTTGAGACGGG + Intronic
1060345227 9:122810015-122810037 TTTGTTTTGTTTTTTGAAACAGG - Intronic
1060363424 9:122983162-122983184 TTTGTTTTTTTTTTTTTTGCTGG - Intronic
1060502064 9:124165804-124165826 TGTTTGTTGTTTTTTGAGGCAGG - Intergenic
1060548117 9:124472509-124472531 TTTGTTTTGTTTTTTGGAGATGG + Intronic
1060606902 9:124922850-124922872 TTTGTTTTGTTTTTAACTACTGG - Intronic
1060614825 9:125003570-125003592 TTTGTTTTTTTTTTTCTTGCAGG - Exonic
1061021408 9:128017797-128017819 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1061040117 9:128136649-128136671 TTTTTTTTTTTTTTTGCTGTGGG - Intergenic
1061323243 9:129845519-129845541 TTTTTGTTGTTTTTTGATTTTGG + Intronic
1061358290 9:130123049-130123071 TTTCTGTTGTTTTTTGAGACTGG + Intronic
1061364145 9:130162378-130162400 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1061401609 9:130371408-130371430 TTTGTTTTTTTTTTTTCTGCAGG - Intronic
1061581064 9:131536433-131536455 TTTGTTTTGTTTTGTTTTGCTGG - Intergenic
1062307600 9:135918129-135918151 TTTTTCTTTTTTTTTGCTACAGG - Intergenic
1062511096 9:136906635-136906657 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1062700078 9:137895045-137895067 TTTGTTTTGTTTTTTGCCTGTGG + Intronic
1062728174 9:138090694-138090716 TTTTTTTTTTTTTTTGCTGATGG - Intronic
1203706847 Un_KI270742v1:58081-58103 TTTGTGTTGTTTTTTGAGATAGG + Intergenic
1203556400 Un_KI270744v1:1421-1443 TTTGTGTTGTTTTTTGAGATAGG - Intergenic
1203655659 Un_KI270752v1:21791-21813 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1185548555 X:965726-965748 TTTGTGTTTTTTTTTGTGGGGGG + Intergenic
1185727943 X:2437772-2437794 TTTGTTGGGTTTTTGGCTGCTGG - Intronic
1185790189 X:2923455-2923477 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1185953445 X:4462240-4462262 TTTGTCTTGTTTTCTCCTACCGG - Intergenic
1186150193 X:6666429-6666451 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1186192084 X:7076121-7076143 TTTGTTTTGTTTTTTGCCCAGGG - Intronic
1186197717 X:7126451-7126473 TTTGTGTTATTTTGTGATGGCGG - Intronic
1186318311 X:8395340-8395362 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1186472581 X:9832923-9832945 TTTGTGTTGGTTTTTGAAGCAGG + Intronic
1186575474 X:10760819-10760841 TTTGTTTTGTTTTTAGAGGCAGG - Intronic
1186691143 X:11977352-11977374 TTTGTGTTGCTTATTCCTCCTGG + Intergenic
1186872884 X:13789849-13789871 TTTGTTTTGTTTTTTGAAACAGG + Intronic
1187033520 X:15513089-15513111 TTAGTGATGTTTTGGGCTGCAGG + Intronic
1187644051 X:21327721-21327743 TTTTTCTTCTTTTTTGATGCAGG - Intergenic
1187646427 X:21352177-21352199 TTTGTTTTGTTTTTTTTGGCTGG - Intergenic
1187740206 X:22347602-22347624 TTTGAGTTGATTTTTGCAGATGG + Intergenic
1187856462 X:23641101-23641123 TTTGTGTTGGTTTTTGTTTATGG - Intergenic
1187914141 X:24137675-24137697 TTTTTGTTGTTTTTTGAGACAGG + Intergenic
1188415256 X:29925431-29925453 TTTTTTTTTTTTTTTGCTGGGGG + Intronic
1188610542 X:32090758-32090780 TTTGGGTTTTTTTTTTCTGCTGG + Intronic
1188821659 X:34783035-34783057 TTTGTGCTGTGATTTGCTTCAGG + Intergenic
1188852011 X:35143633-35143655 TTAGTGTTGGTCTTTGTTGCTGG + Intergenic
1189111851 X:38299141-38299163 TTTCTGTGGATTTATGCTGCAGG - Exonic
1189276877 X:39792999-39793021 TTTGTTTTGTTTTTTTGTGGGGG + Intergenic
1189392738 X:40590382-40590404 TTTGTTTTGTTTTTTGCTACAGG + Intronic
1189399321 X:40651430-40651452 TTTGTTTTGTTTTTTAAGGCAGG - Exonic
1189486331 X:41435441-41435463 TTTGTGTTTTTTTTTGGGGAGGG + Intergenic
1189572586 X:42314858-42314880 GTTGTTTTGTTGTTTGCTGTGGG + Intergenic
1189993486 X:46616335-46616357 TTTGTTTTGTTTTTTTTTGGGGG - Intronic
1190071043 X:47279570-47279592 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1190096588 X:47486084-47486106 TTTTTGTTTTTTTTTGCGGGGGG - Intergenic
1190338047 X:49274786-49274808 TCTGTTTTGTTTTTTGAAGCAGG - Intronic
1190378353 X:49813381-49813403 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1190468281 X:50749204-50749226 TTTGTATTGTTTTTTGACACAGG - Intronic
1190996623 X:55616554-55616576 TCAGTGTTGGTTTCTGCTGCTGG + Intergenic
1191191353 X:57671244-57671266 TTTGTTTTGTTTTTTGTTTCTGG - Intergenic
1191588225 X:62851943-62851965 TCAGTGTTGGTTTCTGCTGCTGG - Intergenic
1191596851 X:62954367-62954389 TTGGTGTTATTTTTAGATGCAGG - Intergenic
1191826257 X:65367829-65367851 TTTGTGTTGTTTCTTGGTGCCGG - Intronic
1191832633 X:65431385-65431407 TTTGTATTTGTTTTTGTTGCTGG + Intronic
1191933037 X:66395077-66395099 TCAGTGTTGGTCTTTGCTGCTGG - Intergenic
1191946478 X:66539953-66539975 TCAGTGTTGGTGTTTGCTGCAGG - Intergenic
1191995828 X:67094420-67094442 TTTGTGTTCTTTGTATCTGCCGG - Intergenic
1192419662 X:71018013-71018035 TTTGTGATTTTTTTTTCTGATGG + Intergenic
1192457557 X:71289775-71289797 TTTGTTTTGTTTTTTGGAGACGG + Intronic
1192504733 X:71674893-71674915 TTTTTGTTCTTTTTTGATGTGGG + Intergenic
1192673128 X:73167476-73167498 TCAGTGTTGTTCTCTGCTGCTGG + Intergenic
1192736163 X:73851293-73851315 TTCGTGTTGGGTTTTGCCGCAGG - Intergenic
1192869509 X:75172762-75172784 TTGGAGTTGTTTTTTCCTCCCGG + Intergenic
1192970314 X:76221515-76221537 TTTTTTTTTTTTTTTGCAGCTGG - Intergenic
1193071704 X:77312964-77312986 TTTGTCTACTTTTTTGATGCAGG - Intergenic
1193368751 X:80666839-80666861 TTTGTGTTGTTTTTTGGTAGAGG - Intergenic
1193480366 X:82019913-82019935 TCAGTGTTGGTTTTTGCTACTGG - Intergenic
1193609448 X:83611319-83611341 TTTGTTTTTTATTTTGTTGCTGG - Intergenic
1193609663 X:83614380-83614402 TTTGTTTTGTTTTTTGATAATGG - Intergenic
1193719748 X:84973337-84973359 TTTCTGTTGTTTTTGTCTTCTGG - Intergenic
1193833080 X:86311039-86311061 TTGGTGTTGATCTCTGCTGCTGG - Intronic
1194206098 X:91013623-91013645 TTTGTCTTGTTTTCTGCTGTTGG + Intergenic
1194225068 X:91246107-91246129 TTTCTGTGGTTCTTTGCAGCTGG + Intergenic
1194641435 X:96407975-96407997 TTGGTGTTGTTTTTTGCCTATGG - Intergenic
1194693751 X:97019319-97019341 TTTGTTTTGTTTTTTGATATCGG + Intronic
1194803333 X:98298045-98298067 TTTTTTTTTTTTTTTCCTGCTGG + Intergenic
1194823762 X:98536231-98536253 TTTGTCTTCTTTTTTGATGTAGG - Intergenic
1194972724 X:100362010-100362032 TTGGTCCTGATTTTTGCTGCTGG - Intronic
1194986757 X:100498406-100498428 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1195161692 X:102177942-102177964 TTTTTTTTTTTTTTTGCTGCAGG + Intergenic
1195227004 X:102806796-102806818 GTTGAGTTGTTTTATGGTGCAGG - Intergenic
1195248498 X:103019293-103019315 TTTGTTTTGTTTTTTTCTCTTGG + Intergenic
1195576725 X:106460012-106460034 TTTGTTTGTTTTTTTGCTGGAGG - Intergenic
1195688890 X:107607936-107607958 TGTGTGATGTTTTCAGCTGCAGG + Intergenic
1195780320 X:108455334-108455356 TTTGGGTTGTTTTTTGTTTGTGG + Intronic
1196020115 X:110982606-110982628 TTTGTTTTGTTTTGTTTTGCTGG + Intronic
1196294341 X:113981264-113981286 TTTGTTTTGTTTTTTCCTAAGGG - Intergenic
1196592211 X:117498858-117498880 TTTTTTTTCTTTTTTGCTGTAGG - Intergenic
1196749824 X:119105955-119105977 TTTGTTTTGTTTATTGTTGTAGG - Intronic
1196758072 X:119175556-119175578 TTTTTTTTTTTTTTTGCTTCTGG - Intergenic
1197025283 X:121740415-121740437 TTTTGGCTGGTTTTTGCTGCTGG + Intergenic
1197041632 X:121943499-121943521 TTTGTTTTGTTTTTTGGTGGGGG - Intergenic
1197131551 X:123011116-123011138 TTTGTGTTTTTTGTAGATGCTGG - Intergenic
1197222684 X:123928903-123928925 TTTGTTTTGTTTTTTTTTGTAGG - Intergenic
1197223768 X:123936727-123936749 TTTGTTTTGTTTTTTGATACAGG - Intergenic
1197226261 X:123959871-123959893 TTTGTTTTGCTTTTTGCTTCGGG - Intergenic
1197412101 X:126129835-126129857 TGTTTGTTGTTTTTTGTTTCAGG + Intergenic
1197425006 X:126285733-126285755 TTTTTTTTTTTTTTTGATGCTGG - Intergenic
1197508867 X:127345855-127345877 TTTTTTTTCTTTTTTGATGCAGG + Intergenic
1197658714 X:129146537-129146559 TCTCTGTTGTTTTTTGGTGAAGG - Intergenic
1197789444 X:130238022-130238044 TTTGTGTTGTGTTTGGCTTGCGG + Intronic
1197950968 X:131896025-131896047 TTTGTTTTGTTTTTTGAGACAGG - Intergenic
1198053278 X:132969458-132969480 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1198100733 X:133419531-133419553 TTTTTTTTTTTTTTTGATGCAGG + Intergenic
1198149432 X:133893855-133893877 TTTGTTTTGTTTTTTGAGACAGG + Intronic
1198188446 X:134279065-134279087 TTTGTTTTGTTTTTTGTTTTTGG + Intergenic
1198514914 X:137397004-137397026 TTTGTCTTCTTGTTTGCTGTGGG + Intergenic
1198827539 X:140714855-140714877 TTTTTGTTTGTTTTTGTTGCTGG - Intergenic
1199267785 X:145848491-145848513 TTTTTTTTTTTTTTTGCTACTGG - Intergenic
1199756078 X:150866115-150866137 TTTGTTTTGTTTTTTGAGACAGG - Intronic
1199796797 X:151206323-151206345 TGTCAGTTGTTTTTTGCTGGAGG - Intergenic
1199810620 X:151345145-151345167 TTTGTTTTGTTTTCTTTTGCAGG - Intergenic
1200258008 X:154595372-154595394 TTTGTGTTATTTTGTTCTGATGG + Intergenic
1200551857 Y:4588434-4588456 TTTGTCTTGTTTTCTGCTGTTGG + Intergenic
1200561532 Y:4709414-4709436 TTTCTGTGGTTCTTTGCAGCTGG + Intergenic
1200867860 Y:8064636-8064658 TTTGTTTTGTTTTTTGCTTTTGG + Intergenic
1200930539 Y:8693009-8693031 TCTGTGTTTATTTTTTCTGCAGG + Intergenic
1201081560 Y:10256286-10256308 TTTGTGTAGTTTTTTGGGGAAGG + Intergenic
1201096124 Y:10617863-10617885 TTTGTGTAGTTTTTTGGGGAAGG + Intergenic
1201261710 Y:12165045-12165067 TTTGTTTTGTTTTTTAAGGCAGG - Intergenic
1201602046 Y:15741693-15741715 TTTGTGCTGTTTTATGCAACAGG - Intergenic
1201610625 Y:15839430-15839452 TTTTTTTTTTTTTTTGCTGTAGG + Intergenic
1201647540 Y:16252418-16252440 TTTGTTTTGTTTTTTGGAGATGG + Intergenic
1201655271 Y:16332883-16332905 TTTGTTTTGTTTTTTGGAGATGG - Intergenic
1201783767 Y:17751042-17751064 TTTGTGTTCTTTGTTGATTCTGG - Intergenic
1201817786 Y:18154945-18154967 TTTGTGTTCTTTGTTGATTCTGG + Intergenic
1201918691 Y:19210466-19210488 TTTGTTTTGTTTTTTGAGACAGG + Intergenic
1201955409 Y:19617361-19617383 TTTGTTTTGTTTTTTCCCACGGG - Intergenic
1202093257 Y:21216111-21216133 TTTGTTTTGTTTTTAGATGAAGG - Intergenic
1202182175 Y:22148989-22149011 TTTGTTTTGTTTTTTGCAGTGGG + Intergenic
1202209185 Y:22437413-22437435 TTTGTTTTGTTTTTTGCAGTGGG - Intergenic