ID: 1021856821

View in Genome Browser
Species Human (GRCh38)
Location 7:24865211-24865233
Sequence CTTTACAAGCAAAATATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 274}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021856821 Original CRISPR CTTTACAAGCAAAATATGGA AGG Intronic
909344802 1:74572618-74572640 CTTTGCAAGGAAGATGTGGAAGG - Exonic
910272766 1:85414942-85414964 TTTTAAAATCAAAATTTGGAAGG + Intronic
912114670 1:106390591-106390613 CAAAACAAGCAAAAGATGGATGG + Intergenic
912531526 1:110327345-110327367 CTTTAAAAACAAAACAAGGAAGG + Intergenic
912842317 1:113049897-113049919 GTTTGCAAGGAAAATATGGCTGG + Intergenic
913670473 1:121093521-121093543 CTTTACAACTAAAATAATGATGG - Intronic
914022240 1:143880962-143880984 CTTTACAACTAAAATAATGATGG - Intergenic
914660726 1:149788888-149788910 CTTTACAACTAAAATAATGATGG - Intronic
917452334 1:175157630-175157652 CTTTCCAAGAAAAATATAAAGGG - Intronic
917986224 1:180322034-180322056 CTTAACAAGCTAGATATAGAAGG - Intronic
918028106 1:180773736-180773758 CTCTTAAAGCAAAACATGGAGGG - Intronic
918910528 1:190562816-190562838 CTTTACAGGCACAAGATGGGGGG - Intergenic
918970712 1:191414222-191414244 AATCACAATCAAAATATGGAAGG - Intergenic
919648944 1:200126162-200126184 CTTTAAAATCATAATTTGGAAGG + Intronic
921883301 1:220277808-220277830 CTTTACAACTAAAATAGAGATGG + Intergenic
921965636 1:221085688-221085710 CTTTACATGAAAAATGAGGATGG + Intergenic
923737318 1:236622924-236622946 ATTTCCAAGCAAAATGTTGAAGG + Intergenic
1063045571 10:2388646-2388668 TTTTACAAGAAAAATAAGAAGGG - Intergenic
1064337259 10:14454896-14454918 CCTCACAGGCAAAATATGAAAGG + Intronic
1065445079 10:25789912-25789934 TTTTACAAGCAATATAATGAAGG + Intergenic
1065796317 10:29311665-29311687 CTTTAATAGCAAAATATGTCAGG - Intronic
1069619508 10:69828085-69828107 CTTTACATGCAAATAATTGATGG + Intronic
1071073321 10:81721479-81721501 ATTCACCATCAAAATATGGAAGG + Intergenic
1071345736 10:84690424-84690446 ATTTTCAGGTAAAATATGGAAGG + Intergenic
1072798225 10:98373130-98373152 CCATACAAGCAAAATATAAAGGG - Intergenic
1073416223 10:103385027-103385049 CTTTACAAGAAAAAAATAGCAGG - Intronic
1073885925 10:108039621-108039643 CTTTAAAAGCAGATTATTGATGG + Intergenic
1075265058 10:120993388-120993410 ATTTACATGCAAAATGTGCAAGG + Intergenic
1075508312 10:123046782-123046804 TTCTAGAAGTAAAATATGGAAGG - Intronic
1077703800 11:4465110-4465132 GTTTCTAAGCAAAATATAGAAGG + Intergenic
1077997747 11:7468538-7468560 GTTTAGAAGCAAAACATGAAGGG + Exonic
1078235387 11:9479968-9479990 GTTGAAAAGGAAAATATGGAGGG - Intronic
1079761700 11:24337678-24337700 CTTTGCAAGTAAAATCTAGAAGG - Intergenic
1080437877 11:32262885-32262907 ATTTCTAAGCAAAATATTGAAGG - Intergenic
1080565820 11:33508458-33508480 CTTTACAGGCAAAAGAGGAAAGG + Intergenic
1080670375 11:34371234-34371256 CTTCATAAGCAAAATATGTGTGG - Intergenic
1083864284 11:65445379-65445401 CTTTACAAGGGAAGTAAGGAAGG + Intergenic
1085834502 11:79937897-79937919 CTATATATGCAAAAGATGGATGG - Intergenic
1085879969 11:80454940-80454962 ATTTCTAAGCAAAATATGGAAGG - Intergenic
1086158876 11:83698813-83698835 CTTTACAACCACACTCTGGAAGG - Intronic
1086675662 11:89603921-89603943 CTTTACAAAATCAATATGGAGGG - Intergenic
1087537655 11:99470777-99470799 ATTTACAATTAAAATATAGAAGG + Intronic
1088314034 11:108488997-108489019 CTGTAAAAGCAAAACTTGGAAGG + Intronic
1089187558 11:116630015-116630037 ATTTCTAAGCAAAATATGGAGGG - Intergenic
1092747170 12:11684369-11684391 CTTTCTAAGCAAAATATTAAAGG - Intronic
1093489150 12:19684887-19684909 CCATTCAAGCAGAATATGGATGG + Intronic
1093875511 12:24344789-24344811 CTTTAAAAGCAAAACTTGGGAGG + Intergenic
1093928924 12:24935719-24935741 CTTTCCAAGTAAAGTATTGAAGG - Intronic
1094669870 12:32559338-32559360 CTTTACAGGAAAAAAATGTACGG - Intronic
1096875609 12:54628039-54628061 ATTTCTAAGCAAAATATAGAAGG + Intergenic
1097648764 12:62268702-62268724 TTTTAAAAGCAAAGAATGGAGGG - Intronic
1098634896 12:72770611-72770633 GTTTCCAAGCAAAATGTTGAAGG - Intergenic
1099828006 12:87803403-87803425 ATTTACAAGCAAAAGAAAGAGGG + Intergenic
1099873521 12:88376683-88376705 ATTTCTAAGCAAAATATTGAAGG - Intergenic
1100039373 12:90295306-90295328 CTTTAGAAGCAGACAATGGAAGG - Intergenic
1106203905 13:27570898-27570920 CTTCACAAACGAAATATGTAAGG + Intronic
1106206428 13:27600449-27600471 CTATACATGCAAAATATATATGG + Intronic
1106248558 13:27967784-27967806 CATTTCAAGCAAAAGCTGGAAGG - Intronic
1106656841 13:31755643-31755665 CTTTACAAGCAAGAAATTAAGGG + Intronic
1107320931 13:39187579-39187601 ATTTAGAAGCAAAATAGGGAAGG - Intergenic
1107910123 13:45097841-45097863 CTTCACAAGAGATATATGGATGG + Intergenic
1108263378 13:48680024-48680046 CTTTACAAGGAAATAATGGTAGG - Intronic
1108426597 13:50308354-50308376 CTTTACATGGAAAATATAAAAGG - Intronic
1110189791 13:72717226-72717248 ATTTCCAAGCAAATTGTGGAAGG - Intronic
1110297264 13:73882830-73882852 ATTTTAAAGCAAATTATGGAAGG + Intronic
1110642403 13:77840743-77840765 CCTTACAAGCAAAGAATAGAAGG - Intergenic
1111954655 13:94743100-94743122 CATTATAGGCAGAATATGGAAGG + Intergenic
1114230442 14:20776844-20776866 CTTCAAAAGGAAAATATGGAAGG - Intergenic
1114743735 14:25124511-25124533 CTTTATCAGCAACATATGCATGG + Intergenic
1116095493 14:40361713-40361735 ATTTACTAGGAAATTATGGAAGG + Intergenic
1116451239 14:45068703-45068725 CATTACAAAAAAAGTATGGATGG - Intronic
1117976409 14:61301250-61301272 GTTCACAAGCTAAATCTGGAAGG + Intronic
1119561548 14:75594001-75594023 ATTTCTAAGCAAAATATTGAAGG - Intronic
1121002031 14:90458226-90458248 CTTTTCAAGCAAAAGGTGAAGGG + Intergenic
1124090591 15:26596147-26596169 CTTTACAGGCAAGATAAGGAGGG + Intronic
1125043690 15:35221895-35221917 ATTTCTAAGCAAAATATTGAGGG - Intronic
1125291497 15:38153184-38153206 CTTTAAAAGAAAAATAAGGAGGG + Intergenic
1125619916 15:41051311-41051333 ATTTACTAGGAAAATATGGTGGG - Intronic
1126272891 15:46843444-46843466 GTTAACACCCAAAATATGGAAGG - Intergenic
1126368858 15:47924727-47924749 TTTAAAAAGCAAACTATGGAAGG + Intergenic
1127720431 15:61693880-61693902 ATTTATAAGCAAAATATTGAAGG + Intergenic
1127739050 15:61880177-61880199 AGTTACAAGCAAATTTTGGAAGG + Intronic
1128784721 15:70386223-70386245 ATTTATAAGCAAATTATGGCCGG - Intergenic
1128927949 15:71675834-71675856 ATTTGCAAGAAAAATATGGCAGG + Intronic
1129057366 15:72830329-72830351 ATTTCCAAGCAAAATATGGAAGG - Intergenic
1130830990 15:87599377-87599399 CTATACAAGGAAAACATGAAGGG - Intergenic
1130963902 15:88683092-88683114 TTTAAAAAGCAAGATATGGAAGG - Intergenic
1133575413 16:7084125-7084147 TAATACAATCAAAATATGGAAGG + Intronic
1134887590 16:17807510-17807532 GTAAACAAGGAAAATATGGAAGG + Intergenic
1135008734 16:18853900-18853922 CTTTAAAAGCAAATGATGGAGGG + Intronic
1135422502 16:22314539-22314561 CTTTACAAACCATAAATGGAAGG - Intronic
1137583347 16:49648277-49648299 ATTTCCAAGCAAACTGTGGAAGG + Intronic
1137996357 16:53218736-53218758 CTTTTTAAGCAATATATGAAGGG + Intronic
1140588254 16:76320278-76320300 CTTTCCAAGCAAAATAGAAAAGG + Intronic
1141237654 16:82233601-82233623 TTTTAAGAGGAAAATATGGAAGG - Intergenic
1142142182 16:88477464-88477486 CTTTAAAAGCCAAACATGGCTGG + Intronic
1143559534 17:7684932-7684954 CTTTACAAACAAAATACGAATGG + Intronic
1143813230 17:9489484-9489506 CTTTACATGCATAATTTGGTGGG - Intronic
1147380858 17:40055272-40055294 ATTTACAGGAAAAAAATGGAAGG - Intronic
1154442132 18:14399605-14399627 ATTTACAAGTAAAATACAGAAGG - Intergenic
1155039706 18:22054727-22054749 GTTTGCAAGCAGAATTTGGAGGG - Intergenic
1155322894 18:24636277-24636299 CTTTACCAGTGAAATTTGGATGG + Intergenic
1155468331 18:26164101-26164123 CTTTACAAGAACAGTTTGGATGG + Intronic
1157748477 18:50157954-50157976 CTCTACAAGTAAAATTTGGGAGG + Intronic
1158373438 18:56834450-56834472 CAAAACAAGCAAAATATGGAAGG - Intronic
1161637114 19:5395849-5395871 CTTGACAGGGAAAATCTGGAGGG + Intergenic
1165724107 19:38100692-38100714 CTGCAAAAGCAAAATCTGGAGGG - Intronic
926492570 2:13542953-13542975 GTTTGCAGGCAAAATAGGGAAGG + Intergenic
926640161 2:15227073-15227095 CTCAACAAGCTAAATATGGAAGG - Intronic
927411163 2:22828032-22828054 CTTCACAAGCAGCAAATGGAAGG + Intergenic
929215562 2:39408186-39408208 CTTTACAGACAAAGCATGGAAGG - Intronic
929259219 2:39845733-39845755 CTTGAAAAGGAAAATGTGGAGGG + Intergenic
932099589 2:68885752-68885774 TTTTGCAAGCAAAATTTGCAGGG + Intergenic
933030748 2:77325841-77325863 CTTCAGAAGCAAACTATGAATGG - Intronic
935560032 2:104550103-104550125 ATTTCCAGGCAAAATATTGAAGG - Intergenic
935570637 2:104657224-104657246 ATTTACAATCAAAATATGTCTGG + Intergenic
935650116 2:105374698-105374720 TTTTAAAAGGCAAATATGGAGGG - Intronic
937656585 2:124383649-124383671 CTTTACTAGCAAAAATTGCAAGG + Intronic
938873687 2:135510252-135510274 CTGTACATGCAAAATAAGCAAGG + Intronic
939058512 2:137392654-137392676 TTTTATAAGCAATATATGGTTGG + Intronic
939350879 2:141036341-141036363 ATTTACAAGAGAAAGATGGAAGG + Intronic
940149824 2:150587574-150587596 CCTTGCAAGAAAAATATGGACGG + Intergenic
941299525 2:163784136-163784158 ATTTACATTCAAAATATGAAAGG + Intergenic
941759092 2:169221138-169221160 CTTTATCAGTCAAATATGGAAGG + Intronic
942899976 2:181103732-181103754 CTTTAAATGGAAAATTTGGAGGG + Intergenic
944001353 2:194842488-194842510 CTTTATAAGCACAAGATGGGGGG - Intergenic
947229032 2:227866875-227866897 CTCTAAAATCAAAATATGTATGG - Intergenic
947255345 2:228157775-228157797 TTTTAGAAGTAAAACATGGAGGG + Intronic
947978929 2:234392253-234392275 CTTCAGAAGCAAAATATTGTGGG - Intergenic
1170229577 20:14030022-14030044 CTTTGCAAGTAAAATCTGCAAGG - Intronic
1171367110 20:24632788-24632810 CTTTACAAGGAAACAAGGGAAGG + Intronic
1173439089 20:43059369-43059391 CTTTCTAAGCAAAATGTTGAAGG - Intronic
1173661417 20:44736858-44736880 CTTTACCAATAAAATATGAAGGG + Intergenic
1176114684 20:63426609-63426631 ATTTCCAAGCAAAGTGTGGAAGG - Intronic
1177638200 21:23812858-23812880 CACTACCAGCAAAATATTGAGGG - Intergenic
1177709117 21:24747905-24747927 CTTAATAACCAAAATATGTAAGG + Intergenic
1178156862 21:29864306-29864328 CTTTACAAGCATTACATGCAGGG + Intronic
1178665551 21:34543311-34543333 CTTTATAAGCAGGATATGGCAGG + Intronic
1180243432 21:46528100-46528122 CTTTCCAAGTAAAGAATGGATGG + Intronic
1181321359 22:22009160-22009182 CTTTATAAGAAAACTGTGGAGGG + Intergenic
1183764733 22:39862251-39862273 TTTTAAAAGCAATATATGGCTGG + Intronic
1184349253 22:43932869-43932891 CTTTAAAAGCGATATGTGGATGG + Exonic
949233169 3:1775293-1775315 ATTTCCAAGCAAAATGTTGAAGG - Intergenic
949762519 3:7487162-7487184 ATTTCTAAGCAAAATATAGAAGG + Intronic
950064583 3:10101677-10101699 CTTTAAGAACAAAATATGGCTGG - Intronic
950915435 3:16640286-16640308 TTTTAAAAGGGAAATATGGAGGG - Intronic
950980144 3:17295120-17295142 CTTTAAAAACAAAATAGTGAAGG + Intronic
952278317 3:31899251-31899273 CTTTTAAAGCTTAATATGGATGG + Intronic
952594413 3:34998773-34998795 ATTTACATGCAGAAGATGGAAGG - Intergenic
952769866 3:36989518-36989540 CTTTACTAGCCAAATTTAGAAGG + Exonic
955252223 3:57295213-57295235 ATTCAGAATCAAAATATGGATGG + Intronic
956012095 3:64842801-64842823 CTTTAGAAGGAAAAGGTGGAAGG + Intergenic
956490571 3:69767299-69767321 CTTTAAAGACAAAAGATGGAGGG + Intronic
957307597 3:78478219-78478241 TTTAAAAATCAAAATATGGAAGG - Intergenic
958419618 3:93915509-93915531 ATTTCTAAGCAAAATATTGAAGG - Intronic
958871878 3:99569195-99569217 CTTTAAAAACAAAACATGCAGGG - Intergenic
959885474 3:111494289-111494311 CCTTACAAGCTAAAAATGAATGG - Intronic
959905269 3:111704251-111704273 CTTTGCAAGTAAAATCTAGAAGG - Intronic
962154180 3:132927036-132927058 CTTTAAAAGTAAAATATGGCCGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963982500 3:151555338-151555360 CTTTGCAAGCAGAATTTAGAGGG + Intergenic
964427822 3:156571674-156571696 CTTTCCAAGGAGAATATGGTGGG - Intergenic
964979299 3:162659737-162659759 CTTCACATGCAAATAATGGATGG - Intergenic
965172558 3:165285579-165285601 TTTTACAAGCAAAAAATAAAAGG + Intergenic
965976641 3:174632456-174632478 CTATAAAAGCAAAAAATAGAAGG + Intronic
966338805 3:178902180-178902202 ATTTGTAAGCAAAATATAGAAGG + Intergenic
968885228 4:3325989-3326011 CTCAACAAACAAAATATAGAAGG + Intronic
969895949 4:10304827-10304849 CTTTAGAAGTAAAAAATTGAAGG - Intergenic
971930106 4:33070401-33070423 ATTTTCAAGCAAAGTGTGGAAGG + Intergenic
972471334 4:39407551-39407573 CACTACAAGAAAAATATGGGGGG + Exonic
973847237 4:54925273-54925295 ATTCCCAAGCAAAGTATGGAAGG - Intergenic
976776217 4:88708998-88709020 CTTAAGAAGGAAAATGTGGATGG + Intergenic
977436563 4:97004047-97004069 ATTTCTAAGCAAAATATTGAAGG - Intergenic
977873401 4:102121004-102121026 CTTTACAAGCAACAGATCAATGG + Intergenic
977904739 4:102463303-102463325 CTTTATAAGCTAAATAAGAAAGG - Intergenic
978451422 4:108838402-108838424 CCTTACAATAAAAATATGTATGG + Intronic
978941862 4:114446418-114446440 CTTTACCAGAAAATTATTGAAGG - Intergenic
980029564 4:127811550-127811572 ATTGAGAAGCAAAATTTGGAAGG + Exonic
980233584 4:130074968-130074990 CTTTTCTGGCAAAATAAGGATGG + Intergenic
981695516 4:147555212-147555234 TTTTTCAATCAAAATATAGAAGG + Intergenic
981796809 4:148605072-148605094 ATTTCTAAGCAAAATATTGAAGG + Intergenic
983728168 4:170956840-170956862 CTTTATAAGCAAAATTCAGAAGG - Intergenic
984019988 4:174474104-174474126 TTTTGAAAGCAAAATTTGGAAGG - Intergenic
984074886 4:175164031-175164053 CTTTAGGGGCAAAAAATGGATGG + Intergenic
985000590 4:185478536-185478558 TTTTAGAAAAAAAATATGGAAGG - Intergenic
987558958 5:19493431-19493453 CTTTCCAAGGAACATAAGGAAGG + Intronic
987837838 5:23184642-23184664 CTTTAGAAGCAAGAATTGGAAGG - Intergenic
990055076 5:51564853-51564875 CTTTAAAAGTAAACTACGGATGG + Intergenic
990167368 5:53009529-53009551 ATTTTCAAGCAAAATATTCAAGG + Intronic
992036351 5:72782311-72782333 ATTTCTAAGCAAAATATAGAAGG + Intergenic
993803974 5:92381077-92381099 ATCTCCAAGCAGAATATGGAAGG - Intergenic
994011480 5:94908276-94908298 CTTTACAAGTAAAATAGTAAAGG + Intronic
994139247 5:96323567-96323589 ATTAAAAAGAAAAATATGGAAGG - Intergenic
994465686 5:100126897-100126919 CTTCATAAGCAGAATATGAAAGG + Intergenic
994523950 5:100880246-100880268 CTTTACAACTAGAATATGCAAGG - Intronic
995196561 5:109376238-109376260 TTTTACAAACAATATATAGATGG - Intronic
995605109 5:113845664-113845686 TTTTACAAGAAAAATCTGGAGGG + Intergenic
995931146 5:117446597-117446619 CTTTATAAGCAGCATATTGAGGG - Intergenic
996057491 5:118997985-118998007 CTTTACATGCAAGATGTGTAAGG - Intergenic
996211454 5:120816311-120816333 CTTTAAAAACAAAATATTAAAGG - Intergenic
996620269 5:125493077-125493099 CTTTTGAAGGAAAATCTGGAAGG - Intergenic
998658663 5:144210548-144210570 CTTTTCAAGCATTATGTGGAAGG + Intronic
998836165 5:146204256-146204278 GTCTAGAAGCAAAATATCGAGGG + Intronic
1001063817 5:168519073-168519095 CTTTTCAGGAAAAATATTGAAGG + Exonic
1001374364 5:171241441-171241463 GGTTACAAGTAAAATCTGGAAGG + Intronic
1003463692 6:6356369-6356391 CTTTACAAAACAAAGATGGAGGG + Intergenic
1003742340 6:8955649-8955671 TTTTAAAGGCAATATATGGATGG + Intergenic
1004240152 6:13913991-13914013 CCTTACAAGCACAAAATGGCTGG - Intergenic
1004493243 6:16138315-16138337 CTTTACAAAAAAAAAAAGGAGGG + Intronic
1006968010 6:38009604-38009626 CTTTTAAAACAAAATCTGGATGG - Intronic
1007220281 6:40273491-40273513 ATTTCCAAGTAAAATATTGAAGG - Intergenic
1008308569 6:49936111-49936133 ACTTACTAGCCAAATATGGAAGG + Intergenic
1008546151 6:52585469-52585491 CTTTAGAAGCAAAGAAAGGAAGG + Intergenic
1011935287 6:92769597-92769619 ATTTCCAAACAAAATATAGAAGG + Intergenic
1012806459 6:103900096-103900118 CATGCCAAGTAAAATATGGATGG + Intergenic
1013166386 6:107596687-107596709 ATTTACAAGAGAAATATTGATGG - Intronic
1014510541 6:122316359-122316381 CTTTTCAAGCATAATATTAAAGG + Intergenic
1014591406 6:123276420-123276442 ATTTTCAAGCAAAGTATGGAAGG + Intronic
1016124035 6:140376654-140376676 CTTTATAAGCCAAAGAAGGAAGG - Intergenic
1016296278 6:142576543-142576565 TTTTACAAGCAAGGTATGTAAGG + Intergenic
1016774112 6:147885423-147885445 CTTTAAAAACAAAATAAGGTTGG + Intergenic
1017466746 6:154701105-154701127 TTTTACACTCAAAATTTGGAAGG + Intergenic
1018255808 6:161917741-161917763 TTTTACAAGCAAAATGAGTATGG - Intronic
1018818504 6:167354557-167354579 CTTTAGAAGCAGACAATGGAAGG - Intronic
1021518274 7:21510524-21510546 CTTTACAAGGCAAAAATGGGAGG - Intronic
1021856821 7:24865211-24865233 CTTTACAAGCAAAATATGGAAGG + Intronic
1022805675 7:33819863-33819885 ATTTCCAAGCAAAGTGTGGAAGG - Intergenic
1024712349 7:52030592-52030614 CTCTAAAAACAAAATATGAAGGG - Intergenic
1028704597 7:93824958-93824980 ATTTAAAAGCAAAATATTGAAGG - Intronic
1030271581 7:107674356-107674378 ACTTACAAGTAAAATATAGATGG + Intronic
1030570459 7:111215506-111215528 CATAACAGGCAAAACATGGAAGG + Intronic
1030858815 7:114597368-114597390 CTTTAAAAGCAAAGTATTGGTGG + Intronic
1031858544 7:126951226-126951248 TTGTACAAAGAAAATATGGAAGG + Intronic
1033469940 7:141637439-141637461 CTGTACCAGCTAAATATGGGCGG + Intronic
1033616606 7:143022577-143022599 ATTTCTAAGCAAAATATTGAAGG + Intergenic
1034055929 7:148035041-148035063 ATTTCTAAGCAAAATATTGAAGG + Intronic
1035741856 8:1934391-1934413 CTTTCTAAGCAAAATCTAGAAGG - Intronic
1037131677 8:15414033-15414055 ATTTCCAAGAAAAATATGGAAGG - Intergenic
1037429967 8:18801011-18801033 CTTTAAAAGCATAATATTTAAGG - Intronic
1037628071 8:20625489-20625511 CGTTACAAGCACAATTTGAAAGG - Intergenic
1038799176 8:30733693-30733715 CTTTAAAAGAAAAATAAGGCTGG - Intronic
1039234578 8:35488014-35488036 GCTTACAAGTAAAATATGAAAGG + Intronic
1040477311 8:47791178-47791200 ATTAATAAGCAAAATATGGCCGG + Intronic
1040876928 8:52163228-52163250 CTATAGAAGCAAAATATTAAGGG + Intronic
1041039448 8:53832103-53832125 CTTTACAGGCATAGTAGGGAAGG + Intronic
1042788489 8:72576766-72576788 GTTTATAAGCAAAACATTGAAGG + Intronic
1043305179 8:78784871-78784893 CTTTTCAAGGAGAAGATGGAGGG - Intronic
1043438993 8:80260382-80260404 CTTTACAGGCACAAGATGGGGGG + Intergenic
1044325404 8:90852586-90852608 CTTTACAGGCAGAGGATGGAGGG - Intronic
1044774775 8:95676930-95676952 CCTTACAAGCCAAATGGGGAAGG - Intergenic
1045321969 8:101088841-101088863 TTTTAAAATCAATATATGGAAGG + Intergenic
1045840350 8:106572548-106572570 ATTTCCAAGCAAAATATCAAAGG - Intronic
1046321694 8:112585810-112585832 ATTTTCAAGCAAATTATGGGGGG - Intronic
1046923345 8:119758610-119758632 CTTTTCAAGCATAATATAAAAGG + Intronic
1048358464 8:133673723-133673745 CTTTATAAGCCAAATGGGGATGG + Intergenic
1049404035 8:142443704-142443726 CTTTACAGGCAAAACAGAGAAGG + Intergenic
1049691519 8:143962778-143962800 ATTTCCAAGCAAAGTGTGGAAGG + Intronic
1050714944 9:8512961-8512983 CTTTACAAGAAAACTATAGGAGG + Intronic
1051556198 9:18385100-18385122 CATTACAAGCAAAATTTGGATGG + Intergenic
1051562123 9:18453626-18453648 ATTTCCAAGCAAAATATTGAGGG - Intergenic
1052730266 9:32277091-32277113 ATTTCTAAGCAAAATATTGAAGG - Intergenic
1053566948 9:39262927-39262949 GTTTATAAGGAAAAAATGGAAGG - Intronic
1053572244 9:39321056-39321078 ATTTACAAACAAAAGATTGAGGG + Intergenic
1053623637 9:39845592-39845614 ATTTACAAACAAAAAATTGAGGG + Intergenic
1053832723 9:42100769-42100791 GTTTATAAGGAAAAAATGGAAGG - Intronic
1053881232 9:42597636-42597658 ATTTACAAACAAAAAATTGAGGG - Intergenic
1053891434 9:42696677-42696699 ATTTACAAACAAAAGATCGAGGG + Intergenic
1054093803 9:60879767-60879789 ATTTACAAACAAAAGATTGAGGG + Intergenic
1054115280 9:61155691-61155713 ATTTACAAACAAAAGATTGAGGG + Intergenic
1054124901 9:61297955-61297977 ATTTACAAACAAAAGATTGAGGG - Intergenic
1054130195 9:61356080-61356102 GTTTATAAGGAAAAAATGGAAGG + Intergenic
1054220263 9:62405107-62405129 ATTTACAAACAAAAAATTGAGGG - Intergenic
1054230452 9:62504065-62504087 ATTTACAAACAAAAAATTGAGGG + Intergenic
1054592475 9:67026851-67026873 ATTTACAAACAAAAGATTGAGGG - Intergenic
1054597830 9:67086641-67086663 GTTTATAAGGAAAAAATGGAAGG + Intergenic
1054847382 9:69811136-69811158 TTTAACAAGGAAAATATAGAAGG + Intergenic
1055426470 9:76201798-76201820 CTTTACAAAGAAATTATGAAAGG - Intronic
1056478352 9:86975136-86975158 CTTTCCAAGCTAAACATGGAGGG - Intergenic
1058289260 9:103217325-103217347 CTTTAGAAACAAAATATTAAAGG + Intergenic
1059685770 9:116634292-116634314 CTTAATAAGCAAAATAGGGCCGG + Intronic
1059883458 9:118718135-118718157 CTTTACAAGCATGATATGATTGG - Intergenic
1185543102 X:920015-920037 CTTTACAAGGAATATATACATGG - Intergenic
1187203629 X:17160155-17160177 ATTTCCAAGCAAAATGTTGAAGG + Intergenic
1187287431 X:17918972-17918994 CTTGAAAAGCAAAATATATAAGG + Intergenic
1187476033 X:19611754-19611776 CTTAAGAAGCAGAATATAGATGG - Intronic
1187944730 X:24415296-24415318 ATTTCTAAGCAAAATATTGAAGG + Intergenic
1189907112 X:45772995-45773017 CTTTAGGAGGAAAATATGGATGG - Intergenic
1191078174 X:56478956-56478978 CTTTACAAGCAAAGCATAGCTGG - Intergenic
1192654567 X:72979369-72979391 TTTTACCAGCAATATATTGAGGG - Intergenic
1193008453 X:76647444-76647466 ATTTCTAAGCAAAATATTGAAGG - Intergenic
1194651537 X:96520757-96520779 TCTTAGAAGCAAAGTATGGATGG + Intergenic
1194842797 X:98764783-98764805 TTATAAAAGAAAAATATGGATGG + Intergenic
1195050363 X:101091135-101091157 CTTTGAAAGCAAAATCTGGCCGG - Intronic
1195526248 X:105893385-105893407 GTGAAGAAGCAAAATATGGAGGG - Intronic
1198613613 X:138429574-138429596 CTTTACCACCAATATATTGAGGG + Intergenic
1199375547 X:147103985-147104007 CTTTACAAGCATAAAATAGGTGG + Intergenic
1199920770 X:152400733-152400755 CTTTAAAAGCAAAAGAGGAAGGG + Intronic