ID: 1021858196

View in Genome Browser
Species Human (GRCh38)
Location 7:24878924-24878946
Sequence CAGCCTGGTCTCCTGGAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 281}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021858196_1021858201 16 Left 1021858196 7:24878924-24878946 CCACATTCCAGGAGACCAGGCTG 0: 1
1: 0
2: 1
3: 28
4: 281
Right 1021858201 7:24878963-24878985 TTTGACTTGACAGAATCTGAAGG No data
1021858196_1021858202 26 Left 1021858196 7:24878924-24878946 CCACATTCCAGGAGACCAGGCTG 0: 1
1: 0
2: 1
3: 28
4: 281
Right 1021858202 7:24878973-24878995 CAGAATCTGAAGGCAAAACCAGG No data
1021858196_1021858198 -9 Left 1021858196 7:24878924-24878946 CCACATTCCAGGAGACCAGGCTG 0: 1
1: 0
2: 1
3: 28
4: 281
Right 1021858198 7:24878938-24878960 ACCAGGCTGTCTCAAAAAATTGG 0: 1
1: 0
2: 0
3: 15
4: 167
1021858196_1021858200 -8 Left 1021858196 7:24878924-24878946 CCACATTCCAGGAGACCAGGCTG 0: 1
1: 0
2: 1
3: 28
4: 281
Right 1021858200 7:24878939-24878961 CCAGGCTGTCTCAAAAAATTGGG 0: 1
1: 0
2: 0
3: 16
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021858196 Original CRISPR CAGCCTGGTCTCCTGGAATG TGG (reversed) Intronic
900418776 1:2546711-2546733 CGGCCCGGGCTCCGGGAATGAGG - Intergenic
900432587 1:2609918-2609940 CAGCCTGGTCCCTTGGGAAGGGG + Intronic
900691322 1:3982234-3982256 CAGCCTGGTCTCCTGGCGCTCGG - Intergenic
900957589 1:5896748-5896770 GAGCCTGGTCTGCCTGAATGGGG - Intronic
901033809 1:6324116-6324138 CAGCCTGGTCTCCTGTATGGTGG - Intronic
901757362 1:11449417-11449439 CAGCCTGGTCTTCTAGCTTGGGG + Intergenic
901887081 1:12230483-12230505 CAGCCTGGCGCCCTGGAATTGGG + Intronic
902331281 1:15732267-15732289 CTGGCTGGTCCCCTGGAGTGTGG + Intronic
902367083 1:15983037-15983059 CAGCCTGGTCAGATGGAAGGAGG - Intergenic
902501693 1:16915141-16915163 CACCCTGATCTTCTGGGATGCGG + Intronic
902652300 1:17844731-17844753 CAGCCTGGTCTTCTGGTGTCAGG - Intergenic
903178319 1:21593343-21593365 CAGCCAGGGACCCTGGAATGTGG - Intergenic
903479147 1:23640264-23640286 CAGCCTCCTCGTCTGGAATGAGG + Intronic
903641447 1:24862995-24863017 CAGCCTGTGCCCCTGGCATGGGG - Intergenic
904596708 1:31651122-31651144 TAGGCTGGTCTCCTGGTATTTGG + Intergenic
904609607 1:31718127-31718149 AAGCCTGGTTTCCTGGACTGTGG + Intergenic
904886450 1:33742221-33742243 CTGGCTGGTCTCTTGGAATCGGG + Intronic
904962821 1:34348091-34348113 CAGCCTGGACTCCGGGACTGTGG - Intergenic
912062177 1:105687014-105687036 CAGCCTGGTCCCCAGGATTCAGG + Intergenic
913159195 1:116129954-116129976 CAGGCTGTTCTCCTGGATGGAGG + Intronic
916089199 1:161294023-161294045 CAGACTGGTCTCCTGGCCTCAGG - Intergenic
919541468 1:198851032-198851054 CAGGCTGGTCTCCTGGCCTCAGG - Intergenic
919593808 1:199537584-199537606 CAGCCTGCTCCCCTGAAATCGGG + Intergenic
919940672 1:202283855-202283877 CAGCCTGGTCTCCAGAGCTGAGG - Intronic
920036932 1:203072175-203072197 CAGCCTGTCCTCCAGGAGTGTGG + Intronic
922032037 1:221810751-221810773 CAGCCTGTCCTACAGGAATGAGG - Intergenic
922582030 1:226705690-226705712 CAGCCTAGCCTCCCGGAATGGGG - Intronic
923050357 1:230387483-230387505 CAGCCTGGCCTCCTGGATGCTGG - Intronic
923092062 1:230748216-230748238 CACCCTGATCTCTGGGAATGGGG - Intronic
923189471 1:231606715-231606737 CATCTTGGTTTCCTGAAATGCGG + Intronic
924632114 1:245750948-245750970 AAGCCTGCTCTCCAGGAATGAGG + Intronic
1062938952 10:1407588-1407610 CAGCCGGGACTCCTGGGCTGAGG - Intronic
1063625898 10:7689656-7689678 CAGCCTGGGCCACTGGAGTGAGG + Intergenic
1065924863 10:30426532-30426554 CAGGCTGGTCTCCTGGGCTCAGG + Intergenic
1067550063 10:47227787-47227809 AAGCCTGGTCCCCAGGACTGAGG + Intergenic
1067744875 10:48928262-48928284 CAGCCTGAACTCCTGTAAAGAGG + Intronic
1068938431 10:62657925-62657947 CAGCCTGGTCCCCAGGATTCAGG - Intronic
1069109255 10:64424890-64424912 CATCCTGGTTTCCTCTAATGAGG + Intergenic
1069724911 10:70571378-70571400 CAGCCTGGGCACCTGAAATGGGG - Intergenic
1070345272 10:75535849-75535871 CAGTGTGGTCTACTGGAAAGTGG + Intronic
1070858295 10:79627778-79627800 CAGCATGATCTCCTGCATTGTGG - Intergenic
1071055347 10:81503140-81503162 CCGCCTGGGCTCCTGCACTGCGG + Intergenic
1073132438 10:101198239-101198261 CAGCCAGGTCTGGTGGAGTGGGG + Intergenic
1075398152 10:122142583-122142605 CACCCTGGACTCCTGCAATCTGG + Intronic
1075963945 10:126594084-126594106 AAGCCTGGTCTTCTGCAATTAGG - Intronic
1077444048 11:2582123-2582145 CAGCCTGGTTTCCCGCAATGTGG + Intronic
1077493016 11:2870759-2870781 GCGCCTGGACTCCTGGAAAGGGG + Intergenic
1081997625 11:47375573-47375595 CAGCCTGGGCTCCTGGGGTCTGG - Intronic
1083442695 11:62687721-62687743 CAGCCTGGCCCCCGGGAAAGAGG - Exonic
1083550855 11:63589222-63589244 GAGCCTGGGCTCCTGGAGTCAGG - Intronic
1083615743 11:64025360-64025382 CAGCCACGCCTCCTGGGATGGGG - Intronic
1083722573 11:64610736-64610758 CACCCTGGTCTCCAGGTAAGGGG + Intronic
1083815056 11:65128057-65128079 CAGCCCCTTCTCCTGGAAAGGGG + Exonic
1084153682 11:67302779-67302801 CAGCCTAGTCTTCTGGAAACCGG + Intergenic
1084181067 11:67446285-67446307 GAGACTGGTCCCCTGGGATGTGG + Intergenic
1084191255 11:67500033-67500055 CAGGCTGGGCTCCTGGGCTGAGG - Intronic
1084591090 11:70091036-70091058 CGGCCTGTTCTCCTGGAGAGGGG + Intronic
1085051082 11:73380601-73380623 CAGCCTGGTCTCCAGGCAGGAGG + Intronic
1086596582 11:88579308-88579330 CAGCCTGGTATTCTCAAATGAGG + Intronic
1086932492 11:92707608-92707630 CAGTCTGGGCTCCTAGGATGGGG - Intronic
1088286005 11:108188754-108188776 CAGTCTGTCCTCCTGGAATGAGG - Intronic
1088505499 11:110522998-110523020 CAGCCTGGTGTGGTGGCATGCGG - Intergenic
1089536028 11:119161265-119161287 CAGCCTGGGCTCTGGGAGTGGGG + Exonic
1089775072 11:120830315-120830337 CAGCCTGGTCTCATGGTAAGAGG + Intronic
1090772763 11:129936020-129936042 CAGCCTGACCTCATGGAAGGAGG + Intronic
1091118414 11:133036820-133036842 CAGCCTGGTTTATTGGCATGAGG + Intronic
1091717928 12:2793301-2793323 CATCCTGGTCTCCCGGAGTTTGG + Intergenic
1092141068 12:6183627-6183649 CAGCCCTGTCTCCTAGACTGTGG - Intergenic
1092478553 12:8839651-8839673 CAGCCTGGTCTCCTGCATCTAGG + Intronic
1096530994 12:52242857-52242879 CTGTCTGGTCTCCTGGCATCGGG + Intronic
1098330080 12:69343964-69343986 CAACCTGGTTTCCTGGTCTGGGG + Intergenic
1099084672 12:78231026-78231048 CAGCCTGGTCTCCTGAGGTCAGG - Intergenic
1100827537 12:98488902-98488924 CAGCCTGGTCTCTTGGGCTTAGG - Intronic
1102523453 12:113493894-113493916 CAGCCTGCCTTTCTGGAATGAGG + Intergenic
1102884203 12:116509017-116509039 CAGCCAGGCTTCCTGGAAGGAGG - Intergenic
1102947138 12:116999690-116999712 CAGCCTGGCCTTCTAGACTGTGG + Intronic
1102961750 12:117098056-117098078 CATCCAGTTCTCCTGGAAAGGGG + Intronic
1104169255 12:126264021-126264043 CACCCTGTTCTCCAGGAAAGTGG + Intergenic
1105534056 13:21247704-21247726 CAGCCTGGTCTGCAGGGAGGGGG - Intergenic
1105856868 13:24382082-24382104 CAGCCAGGTCTATGGGAATGAGG + Intergenic
1106621900 13:31378201-31378223 CAGCATGGCCACCTGGACTGTGG + Intergenic
1108025709 13:46175103-46175125 CAGCTTGGTCATCTGGAATAAGG + Intronic
1110014734 13:70386651-70386673 CAGCCTGGTCTCCAGGTTTCAGG + Intergenic
1110274441 13:73627936-73627958 CATCCTGCTCTCCTGGTCTGTGG - Intergenic
1111014136 13:82355310-82355332 CAGCCTGGACAACAGGAATGAGG - Intergenic
1112108052 13:96263958-96263980 GAGCCTGGCCTCCTGGGTTGTGG + Intronic
1112497263 13:99915123-99915145 TACCCTGGTTTCCTGGAAGGAGG - Intergenic
1112788026 13:102972906-102972928 CATCCTGGCGTCCTGGAGTGAGG + Intergenic
1113432231 13:110261196-110261218 CAGCCTGCTCCCCAGGAAGGGGG + Intronic
1114131958 14:19801421-19801443 CAGCCTGGTCTCCAGTACAGCGG - Intronic
1115314867 14:32015003-32015025 CGGTCTGGTGTCTTGGAATGGGG - Intronic
1115353053 14:32416878-32416900 CAGGCTGGTGTTCTGGACTGTGG + Intronic
1118163002 14:63309682-63309704 CAGCTTGGTCTCCAGGCAAGGGG + Intergenic
1118437922 14:65788260-65788282 CAGACTGGTCTCCTGGCCTTGGG + Intergenic
1118738235 14:68717852-68717874 CAGGCTGGTCTCCTGGCCTCAGG - Intronic
1121907162 14:97757070-97757092 GCTCCTGGTCTCCTGGATTGGGG + Intronic
1122801560 14:104232887-104232909 CAGCCTGGTGTCCTGGTAGTGGG - Intergenic
1122861502 14:104584594-104584616 GGGCCAGGTCACCTGGAATGTGG - Intronic
1123575038 15:21657144-21657166 CAGCCTGGTCTCCCGTACAGCGG - Intergenic
1123611654 15:22099633-22099655 CAGCCTGGTCTCCCGTACAGCGG - Intergenic
1123934037 15:25185548-25185570 CATCCTGGTATCCTGCACTGAGG + Intergenic
1123938665 15:25206179-25206201 CGCCCTGGTCTCCTGCACTGAGG + Intergenic
1125692091 15:41604148-41604170 CAGCCTTGTCTCCCTGAGTGGGG + Intergenic
1129867810 15:78922606-78922628 CAGCCTTTTCTCCCGGAAGGAGG + Intronic
1130170399 15:81506456-81506478 CAGCCTGATCTCCTAGCATCTGG - Intergenic
1131426208 15:92347274-92347296 CGGCCCCGTCTCCTCGAATGTGG - Intergenic
1202983906 15_KI270727v1_random:391388-391410 CAGCCTGGTCTCCCGTACAGCGG - Intergenic
1132762974 16:1519934-1519956 CAGCCTGGTCTCCTGGTCCAGGG + Exonic
1133068953 16:3232979-3233001 CAGCCTGGCCTCGCGGTATGGGG - Intronic
1133191486 16:4136704-4136726 CCGCCTTGTCTCCAGGAACGAGG - Intergenic
1133660867 16:7916190-7916212 AACCCTGCTCTCCTGGAATTTGG - Intergenic
1134974345 16:18558953-18558975 CAGGCTGGTCTCCTGGGCTCAGG - Intronic
1135291962 16:21247543-21247565 CAGCCTGGCCCCATGGAAAGAGG - Intronic
1136057026 16:27698154-27698176 CTGCCTAGTCTCCTGTAATCTGG + Intronic
1137269569 16:46894432-46894454 TGGCCTGGGCTCCTGGCATGGGG - Intronic
1137841903 16:51648758-51648780 CTGCCTGCTCCCCTGGAGTGGGG - Intergenic
1138116673 16:54366404-54366426 CAGCCTGGCCGCCTGGCATGGGG - Intergenic
1139316240 16:66071707-66071729 CAGACTTGTCTCCTAGAAAGAGG + Intergenic
1141188261 16:81804392-81804414 CAGCATTGTCTTCTGGCATGGGG + Intronic
1141241508 16:82269238-82269260 CAGACTGGGTTACTGGAATGGGG + Intergenic
1141294875 16:82758313-82758335 CATCCAGGTCTCCTGGAAATGGG + Intronic
1141663403 16:85453614-85453636 GAGCCTGGTCTCATGGGGTGAGG - Intergenic
1142212908 16:88816809-88816831 CAGCCTGGGCTCCTGCTGTGCGG - Intronic
1144469515 17:15525002-15525024 AAGCCAGATCTCCAGGAATGAGG + Intronic
1144654559 17:17027301-17027323 CAGGCTGGTCTCCTGGGCTCAGG + Intergenic
1144793896 17:17878185-17878207 AAGCCAGGTCCCCTGGAGTGTGG + Intronic
1147012644 17:37463677-37463699 CAGCCTGGACAACTGGAGTGAGG - Intronic
1147214040 17:38888871-38888893 CAGCCTGGTCCCCAGGAAGAGGG - Intronic
1147611913 17:41806868-41806890 GAGCATGGCCTCCTGGAAGGAGG + Exonic
1148746380 17:49920520-49920542 CAGCCAGGACTCCTGGATTCAGG + Intergenic
1150004914 17:61463528-61463550 CAGCCTGGCCCCCTGGGCTGTGG + Intronic
1150335878 17:64330424-64330446 CAGGCTGGTCTCCTGGCCTCAGG - Intronic
1150560298 17:66288725-66288747 CAGGCTGGTCTCCTGACCTGAGG - Intergenic
1157628077 18:49068256-49068278 CAGCCTGGTGACCTTGGATGAGG + Intronic
1159358926 18:67374880-67374902 CAGCCTGGACTCCTCGACTCAGG - Intergenic
1159405065 18:67990499-67990521 CAACCTGGTCTCCTGAAGTGGGG + Intergenic
1159623831 18:70669487-70669509 CAGCCTGATCTCCATGAATGGGG + Intergenic
1160860379 19:1235047-1235069 CCGCCGGGTCTCCTTCAATGAGG - Exonic
1163604205 19:18265253-18265275 CAGCCTGGTGCGCTGGGATGAGG + Exonic
1163734051 19:18967773-18967795 CAGCCTTCTCTCTTGGAATAAGG + Intergenic
1164421684 19:28099103-28099125 CAGACAGGTCTCATGGACTGGGG + Intergenic
1164748531 19:30634049-30634071 CAGCCTGAGCTCCTGGGAAGGGG - Intronic
1165096857 19:33414176-33414198 CAGGGTGGTCTCCAGGGATGTGG + Intronic
1165462837 19:35954161-35954183 ACGCCTGGGCTCCTGGATTGTGG - Intergenic
1168288502 19:55346103-55346125 GAGCGTCCTCTCCTGGAATGGGG - Intronic
926116283 2:10215367-10215389 CAGCCTGCTCTCCAGTAGTGAGG - Intergenic
926166404 2:10524102-10524124 CAGCCTGGTCTCCAGCCACGTGG + Intergenic
927234363 2:20856646-20856668 CCGTCTGGTCTCCTGGACTTTGG + Intergenic
927249090 2:20982064-20982086 CTGCCCGGCCTCCTGGAATGTGG + Intergenic
928547616 2:32343035-32343057 TATCCTGGTGTCCTGGAAAGAGG - Intergenic
928625273 2:33133470-33133492 CTGCCTAGTCTCCTGGAAAGAGG + Intronic
930563858 2:52995204-52995226 CAGTCTGGACACCTAGAATGTGG + Intergenic
930634863 2:53792926-53792948 CAGCCTGACCTCCTGGACTCAGG - Intronic
931978419 2:67668309-67668331 CACCCTGGTTTCCTGGAAGGTGG - Intergenic
933901504 2:86853616-86853638 CAGCTTGGTGTCCTGGAGAGAGG + Intronic
934049407 2:88197913-88197935 CAGCCTGGACCCCTGGGAAGAGG - Intergenic
934991384 2:98924323-98924345 CACCTTGGTCTCCTGGGCTGGGG + Intronic
935135913 2:100301590-100301612 TAGCCTGTTCACATGGAATGTGG - Intronic
935414698 2:102803191-102803213 CACCCTGTGCTCGTGGAATGGGG - Intronic
935524161 2:104145273-104145295 CAGCCTGATTTCCTGGTATTTGG - Intergenic
936071661 2:109375394-109375416 CAGCCTAGGCTCCTGGCAAGGGG - Intronic
937451776 2:122008290-122008312 GAACCTGGAATCCTGGAATGTGG - Intergenic
937603932 2:123774077-123774099 CAGTCTGGTGTCCAGAAATGTGG + Intergenic
937795821 2:126019024-126019046 CAGACTGGTCCCCAGGAAAGAGG - Intergenic
938067237 2:128287734-128287756 CTGACTGGACACCTGGAATGGGG + Intronic
941002709 2:160218641-160218663 CACCCTGGGATCCAGGAATGAGG + Intronic
941035788 2:160567815-160567837 CAGCCTTGGCTCCTGGACTCTGG + Intergenic
941157393 2:161996125-161996147 GAGCCAGGGCTCCTAGAATGAGG + Intronic
948024648 2:234767398-234767420 CAGCCAGGTCTCCTGCCCTGTGG + Intergenic
1169329622 20:4706166-4706188 CACCCTGGGCACCTGGAATGTGG - Intergenic
1170570874 20:17631793-17631815 CAGCCAGCTCTGCAGGAATGAGG - Intronic
1170770826 20:19331050-19331072 CTCCCTGGTCTCCTCTAATGTGG - Intronic
1171264724 20:23761655-23761677 TATCCTAGCCTCCTGGAATGAGG - Intergenic
1171466043 20:25328712-25328734 AAGACTGGCTTCCTGGAATGAGG - Intronic
1171570791 20:26249437-26249459 CAGCCTGGTCACTTGGAGAGAGG + Intergenic
1171771673 20:29326887-29326909 CAGCCTGATCCCCGGGAAAGAGG + Intergenic
1172559653 20:35875585-35875607 CAGCCTGCTCTTCTGACATGTGG + Intronic
1172934109 20:38607378-38607400 CAGCCTGGTCCCCTGAGCTGCGG - Intronic
1173525276 20:43727537-43727559 CAGCCTAGTCTCCTTGGGTGTGG + Intergenic
1174190304 20:48735652-48735674 CACGCTGCTCTCCTGGAATGGGG + Intronic
1175224282 20:57435885-57435907 CAGCCTGTGGTTCTGGAATGCGG + Intergenic
1176217723 20:63956138-63956160 CCGCCTGGCCTCCGGGAGTGGGG + Intronic
1176921255 21:14689957-14689979 CGGCCTGGTTTCATGGAAAGGGG + Intergenic
1176969961 21:15253737-15253759 CAGCCAGGACTCAAGGAATGTGG + Intergenic
1177112234 21:17042395-17042417 CAGTCTGGGCTCCTGGAACTAGG + Intergenic
1177792603 21:25735917-25735939 CAGCCTGCTCAGCTGGGATGTGG + Intronic
1178413999 21:32389204-32389226 CAGCCTTGGGGCCTGGAATGTGG - Intronic
1179288379 21:39997222-39997244 CAGTCTGTTCTCCTGGATTCTGG + Intergenic
1179377390 21:40862839-40862861 GAGCCTGGTCTGCTGGAGTGTGG + Intergenic
1179988005 21:44931965-44931987 CAGCCAGGTGCCCTGGAACGTGG + Intronic
1180572951 22:16746453-16746475 CAGCCTGGTCACTTGGAGAGAGG + Intergenic
1180674326 22:17576886-17576908 CAGCCTGGGCTACTGGAATAGGG - Intronic
1181181293 22:21070264-21070286 CAGCCTGCCCTGCTGGCATGCGG + Intergenic
1181477425 22:23177394-23177416 CAACCAGGTCTGGTGGAATGAGG - Intergenic
1181589439 22:23874799-23874821 CTGCCTGGTCTCCTGGGATCAGG + Intronic
1181632452 22:24158280-24158302 CAGGCTGGTCTCCAGGAAGCAGG - Intronic
1181758783 22:25043494-25043516 CAGAATGGTCTCCTAGAATATGG - Intronic
1181795163 22:25302919-25302941 CTGCCTGGTCTCAGGGATTGGGG + Intergenic
1182094458 22:27616528-27616550 CAGAGTTGCCTCCTGGAATGTGG + Intergenic
1183311900 22:37114535-37114557 CAGCCTGGTCTCTTTGATGGGGG + Intergenic
1183619573 22:38964714-38964736 CACCCTGGTCCCCTGTAAGGGGG - Intronic
1183640373 22:39089005-39089027 CACCCTGGTCCCCTGTAAGGGGG - Intergenic
1183860057 22:40663332-40663354 CAGGCTGGTCTCCTGGCCTCAGG - Intergenic
1184648399 22:45908353-45908375 CAGCCAGGCCTCCTGGGATGTGG + Intergenic
1184839167 22:47042595-47042617 ACGACTGGTGTCCTGGAATGTGG - Intronic
949106172 3:202693-202715 CACCCTGGTGTCATGAAATGTGG + Intronic
952877358 3:37957565-37957587 CAGTCTGGTCACCTGGGACGTGG - Intronic
954237418 3:49267445-49267467 CATCCTGGAATCCTTGAATGTGG - Intergenic
954258870 3:49424642-49424664 CAGCATGAGCTCCTGGCATGGGG - Exonic
954386169 3:50245312-50245334 TAGCATGGTCTCCTGGCCTGTGG + Intronic
954698322 3:52439208-52439230 CAGCCTGTTCCCCAGCAATGAGG + Intronic
954806786 3:53225267-53225289 CAGTCAGGTCTCCTGGGATAGGG - Intronic
956731594 3:72201519-72201541 CAGCCTGGTCTCACAGAGTGAGG - Intergenic
957104741 3:75872465-75872487 CAGCCTGGTCACTTGGAGAGAGG - Intergenic
960028969 3:113038914-113038936 CAACCTAGGCTCCAGGAATGAGG + Intergenic
961199445 3:125032625-125032647 CAAGCTGGTCTCCTGGGAGGAGG + Intronic
961562042 3:127737355-127737377 CAGCCTCGTCACCTGCAATAAGG + Intronic
963077036 3:141356346-141356368 CAGCCTTGCATCCTGGCATGGGG + Intronic
963488748 3:145971951-145971973 CAGCATGGTTTTCTGGAGTGAGG - Intergenic
964477057 3:157106799-157106821 CAGCCGTGTTTCCTGCAATGTGG - Intergenic
966736282 3:183189578-183189600 CCTGCTGGTCTCCTGGCATGAGG - Intronic
967998349 3:195183766-195183788 CACCCTGGTCCCCAGGAAAGGGG + Intronic
971113237 4:23614339-23614361 CAGGCAGGTCTCCAGGAATCTGG + Intergenic
972365904 4:38374137-38374159 CAGCTTTGTCTTGTGGAATGAGG - Intergenic
973162955 4:47041306-47041328 CAAGTTGGTCTCCTGGAAAGAGG + Intronic
974711207 4:65597847-65597869 CTGCTTGGTCACCTGGATTGAGG + Intronic
975689127 4:76948466-76948488 CAGCCTGGCCTCCTGAATTAGGG - Intergenic
976221598 4:82760709-82760731 CAGCCTTGTTTCCAGGGATGGGG - Intronic
977610445 4:99024765-99024787 CAGTCTGGTCTCCAGGAAGAAGG + Intronic
981467636 4:145092399-145092421 CAGCCTGAAATCCAGGAATGGGG + Intronic
984255136 4:177381863-177381885 CAGAGTGGGCTCCTGGAGTGGGG + Intergenic
984941539 4:184936425-184936447 CTGGCTGGTATCCTGGCATGTGG + Intergenic
985490716 5:176921-176943 CAGCTGGGTCACCTGGAAAGTGG + Intronic
985881867 5:2644496-2644518 CTGCCTGCTGTCCTGGAAGGGGG - Intergenic
986266658 5:6196893-6196915 CAGCCTGGTTTGCTGGTGTGTGG - Intergenic
990357100 5:54979353-54979375 CTGCCGGGTCTCCCGTAATGAGG - Exonic
994328643 5:98479934-98479956 TTGCCTGGTGTCCTGGAATAGGG - Intergenic
995285111 5:110379131-110379153 CAGCCTGTACACCTGGAATCTGG - Intronic
996083680 5:119282673-119282695 CAGCCTAGGCCCCTGGCATGTGG + Intronic
996544257 5:124660956-124660978 AAGCCTGGTCACCAGCAATGTGG - Intronic
997980526 5:138465258-138465280 AAGCCTGGGCGCCTGGGATGCGG + Intergenic
998884012 5:146675409-146675431 TACCCTGGTATCCTGGACTGTGG + Intronic
999645874 5:153716594-153716616 CAGCCTGCTCAGCTGGAGTGAGG + Intronic
1000866941 5:166525520-166525542 CAGCCAGTGCTCCTGGATTGGGG - Intergenic
1001219083 5:169883709-169883731 CAGCCGGGTCTTCTGGAGTTTGG + Exonic
1001556063 5:172637991-172638013 CAAGCTGATCTCCTGGGATGTGG - Intergenic
1002343459 5:178532036-178532058 CAGCCTGCACTCATGGGATGTGG - Intronic
1002595079 5:180316907-180316929 GAGCCTAGTCTCAGGGAATGCGG - Intronic
1002660335 5:180787243-180787265 CAGGCTGGTCTCCAGGAAATAGG + Intergenic
1003519688 6:6847776-6847798 CATCCTGGTCACCTGGAATGTGG - Intergenic
1004095015 6:12545051-12545073 CAGCTTGGTTTCCTGGCATGAGG - Intergenic
1005340960 6:24843353-24843375 CAGCTTGGCCTCCCAGAATGAGG - Exonic
1006830064 6:36963227-36963249 CAGCCTGCCCTCCTTGGATGAGG + Exonic
1007378683 6:41472839-41472861 CAGGCAGGGCCCCTGGAATGAGG - Intergenic
1007707388 6:43799182-43799204 GAGCCTGGGCCCCTGGGATGGGG + Intergenic
1008140319 6:47824329-47824351 CAGCCTGATCTCCTTGAATCAGG - Exonic
1010387759 6:75302164-75302186 CAGCCAGGAGTCCTGGACTGGGG - Intronic
1011464834 6:87644488-87644510 CAGGCTGGTCTCCTGAACTCAGG - Intronic
1011729477 6:90245917-90245939 CAGCCTCCTGTCATGGAATGAGG - Intronic
1013467382 6:110429796-110429818 CTGGCTGGCCTCCTGGAAAGCGG + Intronic
1013507054 6:110811462-110811484 CAGGCTGGTCTCCTGGTCTCAGG + Intronic
1016894313 6:149037493-149037515 CAGGCAGGACCCCTGGAATGAGG + Intronic
1017081882 6:150677426-150677448 CAGCCTGGAGTCATGGGATGGGG - Intronic
1017729333 6:157301192-157301214 CAGTGTGCTCTTCTGGAATGGGG + Intronic
1019300070 7:298391-298413 CATCCTGGGCTCCTGGGATCAGG - Intergenic
1019605806 7:1909651-1909673 CGGGCTGGTCTCCGGGAATTTGG - Intronic
1020579520 7:9978080-9978102 CAGTGTGATATCCTGGAATGGGG + Intergenic
1021858196 7:24878924-24878946 CAGCCTGGTCTCCTGGAATGTGG - Intronic
1022112830 7:27241815-27241837 CAGCGAAGTCTCCTGGAAAGAGG - Intergenic
1022473173 7:30694176-30694198 CAACCTGGTCTCCCGGGATTAGG - Intronic
1024551218 7:50564020-50564042 CACCCTGGTCTCCAGGAAAGGGG - Intronic
1030632486 7:111910910-111910932 CAGACAGGTCTCCTGGTGTGAGG - Intronic
1032006141 7:128303467-128303489 TGGCCTGGCCTCCTGGAAAGGGG + Exonic
1034051728 7:147990898-147990920 CAGCCTGATCTCCAGGGAGGAGG - Intronic
1034200636 7:149281280-149281302 TAGCTTGGCCTCCAGGAATGAGG + Intronic
1034900065 7:154902624-154902646 CTGCCTGGGCTCCTGGCAGGTGG + Intergenic
1035333403 7:158111018-158111040 CACCCTGCTCTCCTGGCCTGGGG + Intronic
1036756535 8:11474987-11475009 CAGCCAAGTGTCCTGGAGTGAGG + Intergenic
1037834386 8:22207547-22207569 GAGCCTGGTCTCCAAGACTGGGG + Intronic
1039764897 8:40618280-40618302 CAGCCTGTTCTTCTGTAATGGGG + Intronic
1040551575 8:48441992-48442014 CTGCCTTGCCTCCTGGAATGGGG + Intergenic
1040688922 8:49910881-49910903 CAGCCTAGGCTCCTGCAGTGGGG - Intronic
1040927852 8:52703480-52703502 TAGGCTGATCTCCTGAAATGAGG + Intronic
1041249045 8:55917093-55917115 CAGCCTCGTCTCCTGGGTTCAGG - Intronic
1041405451 8:57494317-57494339 CAGCCCGGTCTCTGGGGATGGGG - Intergenic
1042251890 8:66764497-66764519 CAGCCTGGGCAACTGGAGTGAGG - Intronic
1042399757 8:68331499-68331521 CGGCCAGGTGTCCTGGAACGCGG + Intronic
1047443702 8:124901155-124901177 TAGCATTGTCTCCTGGAGTGAGG + Intergenic
1048047367 8:130785525-130785547 CAGCCTGGGCTCCTGAAAACAGG + Intronic
1049402844 8:142438058-142438080 TGCCCTGGTCTCCTGGCATGTGG + Intergenic
1050360573 9:4826875-4826897 CAGCCTGGCCTCCTGTATGGTGG + Exonic
1056651315 9:88466764-88466786 CAGCCTGGGCTACGGGAGTGAGG - Intronic
1057035580 9:91809763-91809785 CAGCCTGGTCTGTGGGCATGTGG - Intronic
1058111279 9:101033063-101033085 CATCTTGGCATCCTGGAATGAGG + Intronic
1058701122 9:107601098-107601120 CAGACTTGTCTTCTGGAATGGGG - Intergenic
1058745636 9:107987870-107987892 CAGCCTTGGCTCCTGGAAAAAGG + Intergenic
1059331914 9:113541078-113541100 CTGCCTGGGCCCCTGGAATATGG - Intronic
1059345308 9:113624259-113624281 CTGCCTGGTCACTTGGAATCTGG - Intergenic
1060044320 9:120327780-120327802 CAGCCTGGCAGCCTGGAATCAGG + Intergenic
1061491490 9:130947335-130947357 CAGTCTGGGCTCTTGGGATGGGG + Intergenic
1062134387 9:134917166-134917188 CAGCCTGCTCTAGTGGAAGGAGG - Intronic
1062621912 9:137426651-137426673 GAGCCTGCCCTCCTGGGATGGGG - Intronic
1062677093 9:137753010-137753032 CACCCTGGTCTGCGGGAATTGGG + Intronic
1185472505 X:392752-392774 CAGCCTGGCCACCTAGAATCTGG - Intergenic
1188968821 X:36587834-36587856 TAGCCTGGAATCCTGGAATTAGG + Intergenic
1189856953 X:45233183-45233205 CAAGCTGGTCTCCTGGCATCAGG - Intergenic
1190395487 X:49977763-49977785 CAGCCTGGGCTTCTGGAGGGGGG - Intronic
1190861432 X:54348385-54348407 CAGGCTGGTCTCCTGGGCTCAGG + Intronic
1195563438 X:106312893-106312915 TAGCCTCCTGTCCTGGAATGTGG - Intergenic
1198728173 X:139698988-139699010 CAGTCTCCTCACCTGGAATGTGG - Intronic
1199883942 X:152000091-152000113 CAGACTGGTACCCTGTAATGGGG + Intergenic