ID: 1021860217

View in Genome Browser
Species Human (GRCh38)
Location 7:24898549-24898571
Sequence TGGATTGTGAAGGCCATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021860217 Original CRISPR TGGATTGTGAAGGCCATGGA TGG (reversed) Intronic
905012901 1:34759235-34759257 TGGATTGTGTAGGAAATGGGAGG - Intronic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
906711359 1:47932393-47932415 TGGATTGAGAAGACAATGGAAGG + Intronic
907076563 1:51584407-51584429 TGGATTCTAAAGGCCTTGCATGG + Intronic
907185682 1:52607382-52607404 CGGAGTCTGTAGGCCATGGAGGG + Intronic
908643756 1:66254488-66254510 GGGATAGTTAAGGCCATGGCAGG - Intronic
911405572 1:97433697-97433719 TGAATTGGAAAGGCCTTGGAAGG + Intronic
911498034 1:98654392-98654414 CGGATTGTCAAGGACTTGGAAGG - Intergenic
914506567 1:148295086-148295108 TGGATTGTGACAGCCAGGGGGGG - Intergenic
915718489 1:157966115-157966137 TGGAATGTGAAGGCCGGGGAGGG - Intergenic
915994999 1:160553184-160553206 TGGATTCTGAAGACCATTCAGGG + Intronic
917615062 1:176734279-176734301 TGATTTGTCAAGTCCATGGAAGG - Intronic
919479807 1:198074238-198074260 TGGATTCAGAAGGCCATAGAAGG - Intergenic
920113905 1:203606408-203606430 TTGCTTGTGGAGACCATGGAGGG - Intergenic
920168752 1:204056002-204056024 TGCTTTTTGAAGGCCATAGAAGG + Intergenic
920760981 1:208783497-208783519 TGGATAGTGAAGGCAGTGGGGGG - Intergenic
921431365 1:215069816-215069838 GGGATAATGAAGGTCATGGAGGG + Intronic
922218416 1:223539540-223539562 TTGATTCTGAAGGCTAGGGAGGG + Intronic
923702423 1:236312706-236312728 TGGATTTTGATATCCATGGAGGG + Intergenic
923724753 1:236496362-236496384 TGGATGCTGGAGGCCATGCATGG - Intergenic
923878130 1:238073314-238073336 TGGATTGGGAAGAGGATGGAAGG + Intergenic
923998930 1:239529038-239529060 TGGATTATGAAGGAAATGGGAGG - Intronic
924237285 1:242009858-242009880 TGGATTCTGAATGCCCTGGATGG - Intergenic
1064249451 10:13695767-13695789 GCGGTGGTGAAGGCCATGGAGGG + Intronic
1065162664 10:22939109-22939131 TTGATTGTGAAAGACAAGGAAGG + Intronic
1067569256 10:47359750-47359772 TGGATTATAAAGGCCCTGGCAGG + Intergenic
1067711068 10:48651614-48651636 TGGATTGTGCAGGTGATGGTTGG - Intronic
1067905979 10:50291624-50291646 TGGTTTTTGATGGCTATGGATGG - Intergenic
1068826702 10:61448178-61448200 AGGTGTGTGAAGGCCATGTAGGG - Intronic
1069375722 10:67790626-67790648 AGGATTGTCAGGGACATGGAAGG - Intergenic
1070286769 10:75089302-75089324 AATATTGTGGAGGCCATGGAGGG - Intergenic
1070420079 10:76227981-76228003 GGGACTGTGGAGGGCATGGAAGG + Intronic
1070679978 10:78442096-78442118 TGGATGGTGAAGGGGATGGAGGG + Intergenic
1070725066 10:78782099-78782121 AGGGTTGGGAAGGCCTTGGATGG - Intergenic
1071881442 10:89903070-89903092 AGGACTATGAAGTCCATGGAGGG - Intergenic
1072917477 10:99547819-99547841 TGGCTAGTTAAGGACATGGAAGG + Intergenic
1074070927 10:110068538-110068560 TGGATTTTGGTGGCCATGGGAGG + Intronic
1074146416 10:110720896-110720918 ACGAAGGTGAAGGCCATGGAGGG - Intronic
1074537383 10:114338234-114338256 TGGACTGTGATGGCCAGGGCAGG + Intronic
1075427808 10:122355550-122355572 TGGATTGGGGAGGCCAAGGAAGG - Intergenic
1075975357 10:126689518-126689540 TGCACTGGGAAGGCCATGCAGGG + Intergenic
1076124398 10:127962723-127962745 TGGATTGTTATGGCCAAGGAGGG + Intronic
1076274654 10:129186902-129186924 TGCAGTGTGAAGACCATGTAGGG + Intergenic
1076566329 10:131401994-131402016 GGGATTGTGGGGGCCATGGAGGG + Intergenic
1076757358 10:132579443-132579465 GGGATTGTGCAGGGCAGGGAAGG + Intronic
1078300576 11:10127471-10127493 TGGACTGTGGAGGCAATGGAGGG - Intronic
1078633490 11:13027962-13027984 CAGATTGTGGAGGCCAGGGATGG + Intergenic
1079376166 11:19893993-19894015 TGCATTGTGAAAGTTATGGATGG - Intronic
1080773082 11:35360777-35360799 TGGTTTATGGAAGCCATGGAAGG - Intronic
1083332338 11:61904758-61904780 TGCATTGTGAAGTCCAGGCAGGG + Exonic
1083841006 11:65304323-65304345 TGGATGGTTAAGTCTATGGATGG - Intronic
1083861140 11:65420850-65420872 TCGCTTTTGAAGGCCATGGTGGG - Intergenic
1084744964 11:71164157-71164179 TGGGTTGTGAATGCAAGGGAGGG + Intronic
1085299956 11:75452044-75452066 TGGCTTGTGATAGCCATGGTGGG + Intronic
1086234410 11:84610681-84610703 AGGATTGGCAAGGCCAGGGAAGG - Intronic
1091217840 11:133914327-133914349 TGGATTGGGAAGACGCTGGAAGG - Intronic
1091263458 11:134252509-134252531 TGGATTGTTAAGTTTATGGAGGG - Intronic
1091694086 12:2616463-2616485 TGGCTGGGGAAGGCCAGGGAGGG - Intronic
1093286848 12:17274413-17274435 TTGATTGTGAAGGGCCTTGAAGG + Intergenic
1095967100 12:47876051-47876073 TAGATTGTGAAGACCCTGGCTGG + Intronic
1097921441 12:65078872-65078894 GGGTTTGTGAAGGCCAGGCACGG + Intronic
1103196861 12:119051648-119051670 TGCAACGTGAAGGCCAAGGAAGG - Intronic
1104068405 12:125324715-125324737 TGGATGGTGGAGGGCAGGGATGG - Intronic
1105814018 13:24016943-24016965 TGGATGGTGGAGCCCATGGAGGG + Intronic
1106135803 13:26972453-26972475 GGGATTTGGAAGGCCATGGGAGG + Intergenic
1106684959 13:32048994-32049016 TTGATTGTGAAGCCCAGAGAAGG - Intronic
1108726510 13:53188686-53188708 TGGATTGTGAATGTGATGGCTGG + Intergenic
1109714519 13:66204234-66204256 TGGAATGTGGATGCCAAGGAGGG + Intergenic
1110191521 13:72735110-72735132 GGGACTGTGAAGGGCTTGGAGGG - Intronic
1110818496 13:79887183-79887205 TGGACAGTGCAGCCCATGGAGGG + Intergenic
1112112942 13:96322795-96322817 TGTTTTGTCAAGGCCATTGATGG + Intronic
1118916731 14:70114014-70114036 TGGGTTATGAATGCCATGTAGGG - Intronic
1123420726 15:20128557-20128579 TGGAGTTTTAAGGTCATGGAGGG - Intergenic
1123445134 15:20324965-20324987 TGGAGTTTTAAGGTCATGGAGGG + Intergenic
1123529951 15:21135086-21135108 TGGAGTTTTAAGGTCATGGAGGG - Intergenic
1123579981 15:21706202-21706224 TGGATGGTGAGGGCGATTGAAGG - Intergenic
1123616629 15:22148824-22148846 TGGATGGTGAGGGCGATTGAAGG - Intergenic
1128115723 15:65103786-65103808 TGGGTTGTGAAGGACAGAGAAGG + Intronic
1131117943 15:89805893-89805915 TGGATTCTGAGGGCCAAGGAAGG - Intronic
1131378638 15:91945885-91945907 TGGATTGTGATGGAGAGGGAGGG + Intronic
1202988851 15_KI270727v1_random:440447-440469 TGGATGGTGAGGGCGATTGAAGG - Intergenic
1134036558 16:11035888-11035910 AGGATTTTAAAGGCCATGGTGGG + Intronic
1135382521 16:22007166-22007188 TGCAATGAGAAGGCAATGGAGGG - Intergenic
1136163761 16:28438817-28438839 TGGACTGTGAAGGCTGAGGAGGG + Intergenic
1136199203 16:28676166-28676188 TGGACTGTGAAGGCTGAGGAGGG - Intergenic
1136215548 16:28790336-28790358 TGGACTGTGAAGGCTGAGGAGGG - Intergenic
1136260274 16:29070182-29070204 TGGACTGTGAAGGCTGAGGAGGG - Intergenic
1136344747 16:29667436-29667458 TGGATTGTGAAAGCCCTGTTGGG - Exonic
1136721629 16:32323642-32323664 TGGAGTTTTAAGGTCATGGAGGG - Intergenic
1136840011 16:33529929-33529951 TGGAGTTTTAAGGTCATGGAGGG - Intergenic
1137923361 16:52514567-52514589 AGGCTTGTGAAGGCTATGGGAGG + Intronic
1137992923 16:53178195-53178217 TAAATTGTGAAGCCCAGGGAAGG + Intronic
1138409969 16:56831483-56831505 GGGAGTGTGGAGGCCAGGGAGGG + Intronic
1139250936 16:65495292-65495314 TGGATTGAGCAGCCAATGGATGG + Intergenic
1139461790 16:67128461-67128483 TGGATTCTGAAGGTGTTGGATGG - Intronic
1141795768 16:86272900-86272922 TGGAATGTGGATGCAATGGATGG + Intergenic
1142292609 16:89199906-89199928 GGGATTGAGCAGGACATGGAGGG - Intronic
1203004803 16_KI270728v1_random:194128-194150 TGGAGTTTTAAGGTCATGGAGGG + Intergenic
1203136353 16_KI270728v1_random:1730247-1730269 TGGAGTTTTAAGGTCATGGAGGG + Intergenic
1203150178 16_KI270728v1_random:1830214-1830236 TGGAGTTTTAAGGTCATGGAGGG - Intergenic
1142809428 17:2388301-2388323 TGAATTGTGGAGGACAGGGAAGG - Intronic
1143050741 17:4123625-4123647 TGAACAGTGAAGGCCAAGGAGGG + Intronic
1146572624 17:33965999-33966021 TGCATAGTGAAGGCCTTGGCAGG - Intronic
1147634261 17:41953476-41953498 TGGTTTGTGAAGACCTTGGCTGG + Intronic
1148405508 17:47410457-47410479 TGAATTTTGAGGGCCAGGGATGG - Intronic
1149073342 17:52569968-52569990 TGGATTGTGCATTCCATGGTGGG + Intergenic
1151160556 17:72161598-72161620 TGGATTGTGAAGGCCTGGCATGG + Intergenic
1153037216 18:774844-774866 TGGATCTTGAAGGCCATAGTAGG - Intronic
1155980508 18:32174861-32174883 AGGATTGGGAAGCCCATGGGAGG + Intronic
1156080302 18:33326332-33326354 TGGAATGTGAGGGCCCAGGAAGG + Intronic
1157870853 18:51229018-51229040 TGGATTGTCAGGGACTTGGAAGG - Intergenic
1158001686 18:52626902-52626924 TGGATTTTGGAATCCATGGAGGG + Intronic
1161315883 19:3617502-3617524 TGGAGGCAGAAGGCCATGGAAGG + Intronic
1161359685 19:3840899-3840921 TAGATTTTGATGGCCATGCATGG + Intronic
1164150521 19:22546356-22546378 GGGATTCTGAAAGGCATGGATGG + Intergenic
1164655897 19:29921575-29921597 AATATTGTGGAGGCCATGGAGGG + Intergenic
1165124060 19:33581594-33581616 TGGATTGAGCAGGCTATGGGTGG - Intergenic
1165255662 19:34576199-34576221 TGGGTGGTGTAGGCCCTGGATGG + Intergenic
1165830916 19:38729791-38729813 TGGATTGGGGAGGCCTTGAAGGG - Exonic
1167797942 19:51722420-51722442 TGGATTTTGAAGGCCAAGTCTGG + Intronic
925817906 2:7771146-7771168 TGCAGTGTGGAGGCTATGGAGGG - Intergenic
927715225 2:25347543-25347565 TGGTTTGAGAAGAGCATGGATGG - Intergenic
928239448 2:29573856-29573878 TGGAATGTGATGGGCATGGGTGG + Intronic
929052056 2:37845991-37846013 TGGATTTTAATGGCTATGGAGGG - Intergenic
931074955 2:58700409-58700431 TGGATGGTGAATGACGTGGAAGG - Intergenic
931927953 2:67095817-67095839 GGGACTGGGAAGGACATGGAGGG - Intergenic
934865647 2:97807781-97807803 TTGATTGAGAAGGTAATGGAAGG + Intronic
935197554 2:100827190-100827212 TGGATTGAGAAAGGCCTGGAAGG - Intronic
940595362 2:155784558-155784580 TGGATGGTGAAGGTGAGGGAGGG + Intergenic
942987960 2:182164354-182164376 TGGATGGTCAAGGACTTGGAAGG + Intronic
943547572 2:189299947-189299969 TGAATTTTAAAGGCCATAGAGGG - Intergenic
944439503 2:199727722-199727744 TGGATTGATAAGGCAAGGGATGG - Intergenic
946060450 2:216936590-216936612 AGGATAGGGAAGGCTATGGATGG + Intergenic
946137575 2:217660488-217660510 TGGATTCTGAAGGATTTGGAAGG - Intronic
947624506 2:231611419-231611441 TGGATTGGGAAGGCCAGGAGGGG + Intergenic
949000446 2:241610162-241610184 GGGAGTGTGAAGGCCATGCCCGG - Intronic
1169569462 20:6890375-6890397 TGGATTGTAAAATTCATGGAAGG - Intergenic
1169748783 20:8970227-8970249 TGGAATGTGAAGGCCAAGTATGG - Intergenic
1171502107 20:25601877-25601899 TGAATAGTGAAGGCAAAGGAGGG - Intergenic
1172025640 20:31946423-31946445 TGGACTTTGAAGGGCAGGGATGG - Intronic
1172090272 20:32426479-32426501 TTGATTCTGAAGACCATGTATGG + Intronic
1172436515 20:34932426-34932448 AGGATCTTGAAGGCCATGGTAGG - Intronic
1172860185 20:38043533-38043555 TGGATTGTAAAGGCCAAGGGAGG + Intronic
1173523015 20:43712918-43712940 TGGATGGTCATGGCCATGGATGG - Intronic
1173885410 20:46453301-46453323 TGGATTCTCAAGACCATGAAAGG + Intergenic
1174189154 20:48727941-48727963 AGGACTGTGAAGGGCATGGCAGG - Intronic
1174640880 20:52043129-52043151 TGGATTTTTAAGGCCAGGCATGG - Intergenic
1174994553 20:55551284-55551306 CAGATTGTGAAGTTCATGGAAGG - Intergenic
1175000678 20:55626329-55626351 TGGTTTGTGAGGGCCAGGAAAGG + Intergenic
1178027419 21:28483834-28483856 TGGAATGTGATGGCCATACATGG - Intergenic
1180551154 22:16542683-16542705 TGGAGTTTTAAGGTCATGGAGGG + Intergenic
1181352850 22:22271242-22271264 TGGAGTTTTAAGGTCATGGAGGG - Intergenic
1182029512 22:27146838-27146860 TGGCTTGTGAAGGATTTGGAAGG - Intergenic
1183398993 22:37590004-37590026 TGGAGTGTGAAGGCCAGAGAGGG - Intergenic
1183611488 22:38910068-38910090 ACGATTGTCAAGGCCATGCATGG + Intergenic
1185193538 22:49453705-49453727 AGTACTGGGAAGGCCATGGAGGG - Intronic
950202941 3:11057616-11057638 TGGATGGTGAATGGGATGGATGG + Intergenic
950842437 3:15980323-15980345 TGGATCGTAAGGGCCATGAATGG - Intergenic
951483274 3:23183997-23184019 GGGACTGGGAAGGCTATGGATGG + Intergenic
952668347 3:35935347-35935369 TGGGTTGTGAGGGCGATGTAGGG - Intergenic
953325387 3:42008424-42008446 TAGTTTGTGAAGGCCAGGCATGG - Intergenic
953537042 3:43784371-43784393 TGCCTTGGGAAGGCCAAGGAAGG + Intergenic
953679234 3:45027159-45027181 TGGAATGTCATGGCAATGGACGG + Intronic
954294535 3:49666801-49666823 TGGGTTGTGCAGGCCAAGTAAGG + Intronic
955983458 3:64549712-64549734 TGGAAGGTGGAGGCCAGGGATGG - Intronic
956068589 3:65423031-65423053 TGGGTGGTAAAGGCCAGGGATGG + Intronic
960533913 3:118795548-118795570 TTGATCGTGGAGGCCATGGATGG - Intergenic
961540689 3:127597418-127597440 TGTATTCTGAAAGCAATGGAAGG - Intronic
962318957 3:134375465-134375487 TGGATTCTGATAGCCAGGGAGGG - Exonic
963492898 3:146023303-146023325 TAGAGTGTGGAGGCCATGAATGG + Intergenic
964180104 3:153873403-153873425 TGGATTATTAAGGCCAGGCACGG - Intergenic
964361117 3:155897501-155897523 GGTATTATGAAGGCCCTGGATGG - Intronic
965272145 3:166631005-166631027 TGAGTTCTGAAGGCAATGGAGGG - Intergenic
967036768 3:185654014-185654036 TGGATCCTGAGGCCCATGGATGG - Intronic
970411871 4:15816775-15816797 TGGAATTTGCAGGCCATTGAGGG + Intronic
971603685 4:28629837-28629859 TGGATTTTGGAGGACATTGAAGG - Intergenic
972046138 4:34666735-34666757 TTGATTATGGAGGCCATGGAGGG + Intergenic
972064720 4:34926699-34926721 TGGATGGTGAAAGCCATTCATGG + Intergenic
972379404 4:38505149-38505171 TGGGTTACGAAGGCCTTGGATGG - Intergenic
974651446 4:64759076-64759098 TGGATGGTGATGGCCGTGGCTGG + Intergenic
974974134 4:68869066-68869088 TGTTTTGAGAAGGCCTTGGATGG + Intergenic
978232973 4:106423350-106423372 TGGATAGTGAGGGCCCTGGGAGG + Intergenic
979524208 4:121700298-121700320 TGGCTGGGGAAGGCCATGAAGGG - Intergenic
980738897 4:136926171-136926193 TTAATTGTGAAAACCATGGAAGG + Intergenic
982231928 4:153216770-153216792 TACATTGTGAAGGGGATGGAAGG + Intronic
984719393 4:182955824-182955846 TGGTTTGTTAAGGACATGGAAGG + Intergenic
985909887 5:2870859-2870881 ATGATGGTGCAGGCCATGGAGGG + Intergenic
986477019 5:8144807-8144829 TGGATTGTAAAGGACAAAGAAGG - Intergenic
986571917 5:9174547-9174569 TGCATTCTGAAGGACATGGAAGG - Intronic
986591278 5:9373472-9373494 TGGCTTGGGAAGGGCATGGAGGG - Intronic
988090269 5:26530260-26530282 TGCATTGTGCAGTCAATGGAAGG - Intergenic
992615153 5:78540510-78540532 TGTGTTCTGAAGGCCATGAATGG - Intronic
993322137 5:86484667-86484689 TGGATTGTGGATGCCAGGGTTGG - Intergenic
997534654 5:134609598-134609620 TGGATTGTGCAGACCACGAAAGG - Exonic
998951020 5:147393269-147393291 TGGGTTGGGAAGGCCAGGCAGGG - Exonic
999201872 5:149822393-149822415 TGGAGTGTGCAGCCCATGAAAGG - Intronic
999535717 5:152514887-152514909 TGCATTGTGAAGTCCATAAAAGG + Intergenic
999848641 5:155513219-155513241 TGGAATGTGAAGACCATTAATGG + Intergenic
1001404962 5:171469745-171469767 TGAATTGTGAGGGCAAGGGAGGG - Intergenic
1001584833 5:172826807-172826829 TGGATGGTGAAGGACTTTGAGGG - Intergenic
1002884746 6:1283220-1283242 TGGAGTGTGGAAGCCATGGCTGG + Intergenic
1003619507 6:7685706-7685728 TGGTTTGTGGAAGCCAAGGAGGG + Intergenic
1006269389 6:32952155-32952177 TGACTAGAGAAGGCCATGGATGG + Intronic
1006567202 6:34970130-34970152 TGGTGTGTGAAGGCCCTTGATGG - Exonic
1008053846 6:46926595-46926617 TGGAATGTGAAGGCTGTGGACGG - Intronic
1013167639 6:107608022-107608044 TGGGTTGTGAATGCCATCTAAGG + Intronic
1014094733 6:117447374-117447396 TGGCTTATGAAGCCCAAGGAAGG + Intronic
1016892562 6:149021157-149021179 AGGACTGGGAAGGCCCTGGATGG + Intronic
1017107386 6:150900616-150900638 TGGATTGAGAATGCCTTAGAAGG - Intronic
1021465390 7:20937444-20937466 TGGAATGTGAATGTTATGGATGG + Intergenic
1021860217 7:24898549-24898571 TGGATTGTGAAGGCCATGGATGG - Intronic
1022855936 7:34314673-34314695 TGGATGGAGAAGGCCATCTAGGG - Intergenic
1023238166 7:38113219-38113241 TGGATTGTGAATTTAATGGAAGG - Intergenic
1025091741 7:56069872-56069894 TGGATTTTCAAGGCCAGGCATGG - Intronic
1026251099 7:68671452-68671474 TGTAGTGTTAAGGCAATGGAAGG - Intergenic
1026337865 7:69410378-69410400 TGAAATGGGAAGCCCATGGAAGG - Intergenic
1026818168 7:73528613-73528635 TGGATTGTGGAGGGCCTTGAAGG - Intergenic
1028660278 7:93264058-93264080 TGGATTTTGATGTCTATGGAGGG + Intronic
1030537597 7:110788745-110788767 TGGATTGTGTAGTCCAAAGAGGG + Intronic
1030786919 7:113673811-113673833 TGGTTTGTCAAGGGCCTGGATGG + Intergenic
1031989940 7:128190935-128190957 TGGATTGTGAATGGCAGGGCAGG - Intergenic
1033358113 7:140617301-140617323 TTGATATTGAAGGCCATGGAGGG - Intronic
1033858405 7:145594396-145594418 TGGATGGTGAAGGACTTAGAAGG + Intergenic
1034034471 7:147804453-147804475 TGGAGTGTGAAGTCTTTGGAAGG - Intronic
1035927501 8:3744154-3744176 TGGATTGACAAGGGCATGGAAGG + Intronic
1037405786 8:18541058-18541080 TAGATTTTGATGGCCAGGGAAGG - Intronic
1040724222 8:50362141-50362163 TGGATTTTGTAAGCCAGGGAAGG + Intronic
1042070199 8:64924668-64924690 TGGTTTGTGAGGGCCACGGATGG - Intergenic
1044944425 8:97377442-97377464 TGGCTTGTGAAAGCCAGTGAAGG - Intergenic
1047039531 8:120977550-120977572 TGGCTAGTGAGTGCCATGGATGG + Intergenic
1048155284 8:131942071-131942093 AGGATTGTGAATGACAAGGAAGG + Intronic
1048573694 8:135674928-135674950 TGGAATGTGGAGGCAATGGCTGG - Intergenic
1049408307 8:142461402-142461424 TGGACTGTGCAGGCCTGGGAGGG - Intronic
1049563567 8:143325645-143325667 TGGATTGTGAAGGGCTTTGAGGG - Intronic
1049595065 8:143479553-143479575 TGGATAATGAAGGCCAGGGAGGG + Intronic
1050526992 9:6554833-6554855 TCCAGTGTGAAGGCCATGGCTGG + Intronic
1052407607 9:28082153-28082175 TGGATTTTGAAGCCCATCAAAGG + Intronic
1053539480 9:38958810-38958832 AGGATTGGGAAGGCCTGGGAGGG - Intergenic
1054626663 9:67405108-67405130 AGGATTGGGAAGGCCTGGGAGGG + Intergenic
1056506796 9:87265317-87265339 CCGTTTGTGAAGGCCATGGTTGG + Intergenic
1057946925 9:99338205-99338227 TGGATGGTGAAGTCACTGGATGG + Intergenic
1059451728 9:114375439-114375461 TGGATCCTGAGGCCCATGGACGG + Intronic
1059478806 9:114571891-114571913 TGGCTGGGGAAGGCCATGAAGGG - Intergenic
1060861031 9:126954939-126954961 TGGAGGGAGAAGGCCATGGCTGG - Intronic
1062349173 9:136130803-136130825 TGAATTTTGAAGGACATGAAAGG - Intergenic
1185936727 X:4264796-4264818 TGAAATGTGAAGACCATGAAAGG + Intergenic
1186556994 X:10570238-10570260 TGGATTCTGAAGACCTTGCAGGG - Intronic
1187083977 X:16022473-16022495 AGGAGGGTGAAGGCTATGGAGGG + Intergenic
1193367057 X:80647259-80647281 AGTATTGTGACAGCCATGGAAGG - Intergenic
1195262740 X:103149555-103149577 TGGATGGTCAAGGACTTGGAAGG + Intergenic
1196802571 X:119556921-119556943 AGGATTGAGAAGGCCAAAGAAGG + Intronic
1200518189 Y:4175526-4175548 TAAATTGTGAAGAACATGGATGG - Intergenic
1201399029 Y:13582769-13582791 TGAACTGTGGTGGCCATGGAGGG - Intergenic