ID: 1021860272

View in Genome Browser
Species Human (GRCh38)
Location 7:24899111-24899133
Sequence CATCCATTTCTTATGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 190}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021860264_1021860272 29 Left 1021860264 7:24899059-24899081 CCCACCCAGCAAATCTTTTCTTC 0: 1
1: 0
2: 2
3: 26
4: 423
Right 1021860272 7:24899111-24899133 CATCCATTTCTTATGGGACATGG 0: 1
1: 0
2: 1
3: 9
4: 190
1021860268_1021860272 5 Left 1021860268 7:24899083-24899105 CCAGACTAAACAGCCGCATTGTC 0: 1
1: 0
2: 0
3: 12
4: 74
Right 1021860272 7:24899111-24899133 CATCCATTTCTTATGGGACATGG 0: 1
1: 0
2: 1
3: 9
4: 190
1021860267_1021860272 24 Left 1021860267 7:24899064-24899086 CCAGCAAATCTTTTCTTCTCCAG 0: 1
1: 0
2: 5
3: 35
4: 400
Right 1021860272 7:24899111-24899133 CATCCATTTCTTATGGGACATGG 0: 1
1: 0
2: 1
3: 9
4: 190
1021860269_1021860272 -8 Left 1021860269 7:24899096-24899118 CCGCATTGTCATCATCATCCATT 0: 1
1: 0
2: 2
3: 43
4: 440
Right 1021860272 7:24899111-24899133 CATCCATTTCTTATGGGACATGG 0: 1
1: 0
2: 1
3: 9
4: 190
1021860266_1021860272 25 Left 1021860266 7:24899063-24899085 CCCAGCAAATCTTTTCTTCTCCA 0: 1
1: 0
2: 2
3: 32
4: 460
Right 1021860272 7:24899111-24899133 CATCCATTTCTTATGGGACATGG 0: 1
1: 0
2: 1
3: 9
4: 190
1021860265_1021860272 28 Left 1021860265 7:24899060-24899082 CCACCCAGCAAATCTTTTCTTCT 0: 1
1: 1
2: 4
3: 38
4: 519
Right 1021860272 7:24899111-24899133 CATCCATTTCTTATGGGACATGG 0: 1
1: 0
2: 1
3: 9
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021860272 Original CRISPR CATCCATTTCTTATGGGACA TGG Intronic
908677404 1:66620729-66620751 AATACATTTCTTATGTGACATGG - Intronic
911485009 1:98494350-98494372 CATGCAGTTATTATGGAACATGG + Intergenic
915765410 1:158356950-158356972 CATGCTTCCCTTATGGGACATGG - Intronic
920450957 1:206060804-206060826 CCTCCATTTCTTCAGGGTCATGG - Intronic
921340743 1:214131914-214131936 AATCCAAGTCTTATGTGACAGGG - Intergenic
923433159 1:233943186-233943208 CATTCATTTCCTATGAAACAAGG + Intronic
1064310772 10:14209879-14209901 GAGCCTTTTCTTTTGGGACAGGG - Intronic
1065249159 10:23793093-23793115 CACTCATTTCTTCTGTGACACGG - Intronic
1065456622 10:25912865-25912887 CTCCCATTTTATATGGGACAAGG + Intergenic
1065959908 10:30725896-30725918 CGTCCCTTTCTCATGGGACCCGG + Intergenic
1066457259 10:35583134-35583156 CATCTTTTTCTTTTGAGACAGGG + Intergenic
1066986979 10:42476258-42476280 CCTCCGTTTCTTTTGGGACTGGG + Intergenic
1067988745 10:51184069-51184091 CAGCCATGTCTTATAGCACAAGG + Intronic
1069595430 10:69666904-69666926 TTTCCATTTCTTCTGGGCCATGG - Intergenic
1070872346 10:79767433-79767455 CATCTATATCTTATGGGTAAAGG + Intergenic
1071639267 10:87289604-87289626 CATCTATATCTTATGGGTAAAGG + Intergenic
1071655970 10:87448345-87448367 CATCTATATCTTATGGGTAAAGG - Intergenic
1072330982 10:94351532-94351554 TATTCATTTCTTTTGAGACAGGG + Intronic
1073057088 10:100709877-100709899 CATCCACTTCTCAGGGAACAGGG + Intergenic
1074237334 10:111598778-111598800 ATTCCATTTCATTTGGGACAGGG + Intergenic
1074999106 10:118782442-118782464 CATCCATTTGTTAGGCTACAAGG + Intergenic
1075440582 10:122476680-122476702 CCTGCATTTCTGATGGGGCAGGG - Intronic
1078425814 11:11250435-11250457 CAGGCATTGCTTATGGTACAGGG - Intergenic
1079103495 11:17556263-17556285 CTTCCATTTCTGATGACACAGGG + Intronic
1088781569 11:113139531-113139553 TATCAATTTCATATGTGACAAGG + Intronic
1089037374 11:115408696-115408718 CATCCATTTCTTATGTGAAAGGG + Intronic
1089281980 11:117381131-117381153 CAGCCATTTCTGATGTGGCAGGG - Intronic
1090177455 11:124663699-124663721 CAGCCAGTTCTTATGAAACATGG - Intronic
1090665195 11:128910340-128910362 GTTCCATTTCTTAGAGGACAGGG + Intronic
1091309464 11:134562343-134562365 CATGCCTTTCTTAGGGGTCAGGG + Intergenic
1092689325 12:11089310-11089332 CTTCTATTTCTTATTGGTCAGGG - Intronic
1094549943 12:31441336-31441358 CATACATTTTTTTTGAGACAAGG - Intronic
1095149503 12:38775274-38775296 AATACATTTCTGGTGGGACATGG - Intronic
1095373750 12:41501591-41501613 AATACATTTCTTATGGCAGATGG - Intronic
1095916640 12:47486621-47486643 CATCCAAATCTACTGGGACAGGG - Intergenic
1097845218 12:64359347-64359369 CATTTATTTTTTATGTGACATGG - Intronic
1100374140 12:93996724-93996746 CATCAGTTCCTTAAGGGACATGG + Intergenic
1101294536 12:103407690-103407712 CATGGATTTCTTATTGCACAGGG + Intronic
1101703143 12:107194108-107194130 AATGCAGTTCTTATGGGACAAGG - Intergenic
1103125396 12:118417787-118417809 GATCCATTGCTTATGGGGAAAGG + Exonic
1103141016 12:118548445-118548467 TATACATTTCTTATGGAAAAAGG + Intergenic
1105492126 13:20899087-20899109 CCTCCCTTTCTTTTGAGACAGGG - Intronic
1110997892 13:82136903-82136925 AATCCATCTGTTTTGGGACAGGG - Intergenic
1111721898 13:91956315-91956337 CATGCATTACTTATGGGCCTGGG + Intronic
1112120571 13:96405905-96405927 TTTCCCTTTCTTGTGGGACAGGG - Intronic
1113924885 13:113935912-113935934 CGTCCATTTCACATGGCACAAGG - Intergenic
1114825912 14:26079195-26079217 CATCCTTTTCTTAGAGGAAAAGG - Intergenic
1114925983 14:27399557-27399579 CATGCTTTTCTTGTGGGACATGG + Intergenic
1115163553 14:30422991-30423013 TTTCCATTTCTTATTGTACATGG - Intergenic
1116047894 14:39766426-39766448 CATCCATTGTTTAGGGAACAGGG + Intergenic
1118900603 14:69982451-69982473 CATCCATTGCTTGAGTGACAAGG - Intronic
1119076565 14:71646078-71646100 CATCTCTTTCTTCTGGTACAGGG + Intronic
1120393457 14:83938056-83938078 CAACTCTTTCTTATGAGACATGG - Intergenic
1122324219 14:100873173-100873195 CCTCCCTTACTTATGTGACATGG + Intergenic
1122564739 14:102644915-102644937 CAGCCATTTCTTAGGGAAAAGGG - Intronic
1123772171 15:23539763-23539785 CCTCCAATCCTTGTGGGACAGGG - Intergenic
1126871051 15:52988418-52988440 TATGCATTTCTTTTGAGACAGGG + Intergenic
1127005981 15:54570516-54570538 CCTCCATTTTTTATTGAACATGG - Intronic
1127098952 15:55544160-55544182 CAGCAATTTCATATGGTACAAGG - Exonic
1128399246 15:67260709-67260731 AATCTATTTCTCATGGGAGAAGG + Intronic
1129648803 15:77464587-77464609 TATACATTTCTTAGGGAACAGGG - Intronic
1131541382 15:93278254-93278276 CAGCCATTTCTCAGGGGTCAGGG + Intergenic
1131786430 15:95917111-95917133 AATCAATTTCTTATAAGACATGG - Intergenic
1132136534 15:99346181-99346203 CATTCATTTGTTTTGAGACAGGG + Intronic
1134455113 16:14389750-14389772 CATCCTTTTGTTTTGAGACAGGG + Intergenic
1134632925 16:15770106-15770128 GATTCATTTCATTTGGGACAGGG - Intronic
1135028147 16:19014537-19014559 CATCCATGGCATATGGCACACGG - Intronic
1140355203 16:74299383-74299405 CATTCATTTATTTTGAGACAGGG + Intronic
1141819489 16:86435107-86435129 CATCCACTTCTTCTGGGAAGGGG + Intergenic
1146024137 17:29305014-29305036 CATCTAGTTCTTAAGGTACACGG - Intergenic
1146269823 17:31477426-31477448 CATCTATATCTGATGGGTCAAGG - Intronic
1146595614 17:34165898-34165920 CATCTAGGTCTGATGGGACAAGG + Intronic
1147464432 17:40599777-40599799 CATCCATGTCTTATAGGCCCAGG + Intergenic
1149537247 17:57442545-57442567 CACCCATTTCTTCCGGGAGAAGG - Intronic
1149775678 17:59355070-59355092 CCTCAATTTCTTATGATACATGG - Intronic
1150324127 17:64242385-64242407 AATACATTTCTTTTAGGACATGG + Intronic
1155239617 18:23853128-23853150 CATTCCTTTGTTAGGGGACATGG - Intronic
1155398300 18:25410086-25410108 CATCCATGTCTTTCGTGACATGG + Intergenic
1155567808 18:27155690-27155712 CAGCCATTTAGTATAGGACATGG + Intronic
1156094013 18:33508032-33508054 CACACATTTGTTATGGGAGAGGG - Intergenic
1156291216 18:35750049-35750071 AATCAAATTCTTATGTGACATGG - Intergenic
1160495884 18:79374750-79374772 TAACCATTTCTTATGAGCCACGG - Intronic
1161267416 19:3370778-3370800 CATCCATTTGGTGTGAGACAGGG - Intronic
1162691732 19:12439491-12439513 CATCCATTTTTTTTGAGACAGGG + Intronic
1165148279 19:33745940-33745962 CCTCCATTCCACATGGGACAAGG + Intronic
1167379853 19:49132521-49132543 CTTCAACTTCTTATGGGAGATGG - Intronic
925359023 2:3264444-3264466 TATCCAGTTCTTCTGGGGCATGG - Intronic
926013772 2:9429940-9429962 CATCCATTCCTTCTAGGCCAGGG - Exonic
926174382 2:10576457-10576479 CATTCGTTTTTTAAGGGACACGG - Intronic
928164256 2:28958310-28958332 TTTCCTTTTCTTTTGGGACAGGG + Intronic
928171597 2:29007865-29007887 CATCCATTTACGAGGGGACATGG + Intronic
933806326 2:86000430-86000452 CATCCACTTCCTATGGGAGCCGG - Intergenic
933875785 2:86620699-86620721 AATCCATCTCTTATAGAACAGGG + Intronic
934893529 2:98091178-98091200 CAGCCAGGTCTTATGGGACAAGG - Intronic
937104575 2:119297979-119298001 AATTCATTTTTTATGAGACAGGG + Intergenic
938273607 2:129996315-129996337 CATTCATTTATTTTGAGACAGGG - Intergenic
938442610 2:131349791-131349813 CATTCATTTATTTTGAGACAGGG + Intronic
939890847 2:147734365-147734387 CTTCCAGTTCTTAGGGGAAAAGG - Intergenic
940739192 2:157487527-157487549 CATCCATTTATTTCAGGACATGG + Intronic
940749290 2:157606712-157606734 AATACATTTCTTATTTGACAGGG - Intronic
947199885 2:227605568-227605590 CATGCATTTCTTATCAGACCGGG + Intergenic
947617366 2:231566964-231566986 CATCTATTTTTTTTGAGACAGGG - Intergenic
947709516 2:232303908-232303930 TGTCCATTTCTCATGGGACTTGG + Intronic
947810023 2:232998337-232998359 CATACCTTTCTTCTGGGACCTGG - Intronic
949037810 2:241826041-241826063 CATGCATGACTGATGGGACAGGG - Intergenic
1169315551 20:4587780-4587802 CATCAATTTTTTTTGAGACAGGG + Intergenic
1169533384 20:6509640-6509662 TAATCATTTCTTCTGGGACATGG + Intergenic
1174261977 20:49302806-49302828 CATCCCTTTTTTTTGAGACACGG - Intergenic
1174762985 20:53224909-53224931 TCTCCAGTTCTTGTGGGACAGGG - Intronic
1178313559 21:31550804-31550826 CATCCATTTCTAATTTCACAAGG + Intronic
1179898424 21:44376405-44376427 CCTACATTTTTTTTGGGACAGGG + Intronic
1180111120 21:45652275-45652297 CATCCATTACTTTAGGGACCAGG - Intronic
1181160408 22:20956869-20956891 CACCCAGTTCTTTGGGGACAGGG - Intergenic
1181850712 22:25748105-25748127 CAGCCTTTTCTCAGGGGACATGG - Intronic
1182395291 22:30031274-30031296 TTTCCTTTTTTTATGGGACAGGG - Intergenic
1183298371 22:37045499-37045521 CATCCATTTCTCTTTGGTCAGGG - Intergenic
1183502346 22:38188541-38188563 CACCCACTGCTTGTGGGACAAGG - Intronic
949824321 3:8149098-8149120 CATCAATTTCTTCTGCAACATGG + Intergenic
950316163 3:12004078-12004100 CCTCCATTTCAGCTGGGACACGG + Intergenic
952318246 3:32251318-32251340 CATTCATTTTTTTTGAGACAGGG + Intronic
953098325 3:39801076-39801098 TATCCTTTTATTATGTGACAAGG + Intergenic
953497366 3:43399821-43399843 CATCCCCTTCTTATGGCTCATGG + Intronic
953944130 3:47131130-47131152 TAACCATTTCTTGTGTGACATGG - Intronic
953961877 3:47272882-47272904 TATACACTTCTTATAGGACAGGG + Intronic
955036169 3:55270186-55270208 CATGCATTTCTTGTGGGCCCTGG + Intergenic
956088369 3:65637689-65637711 CATACATTTCTTCTAGCACAGGG + Intronic
956365845 3:68501817-68501839 CTCCTCTTTCTTATGGGACATGG - Intronic
957871031 3:86090728-86090750 CACCCATCCCTTATGGCACATGG + Intergenic
959759265 3:109940309-109940331 CATCCAGTAATTATGGGAGAAGG - Intergenic
960439041 3:117664265-117664287 CAGAGATATCTTATGGGACAAGG - Intergenic
964290665 3:155176817-155176839 CATCTATTTTTTCTGAGACAGGG - Intronic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
966224529 3:177583671-177583693 CAACCATTTCTTATTGGGTATGG - Intergenic
968829285 4:2924088-2924110 CAGCCATTCCTGATGGGACCTGG - Intronic
969334833 4:6501660-6501682 CATGCCTTCCTCATGGGACAAGG - Intronic
969686814 4:8680096-8680118 CCTCTAGTCCTTATGGGACAAGG + Intergenic
970841643 4:20478481-20478503 CTTCCATTCCTTGTAGGACAAGG + Intronic
971068246 4:23059579-23059601 CATACGTTTCTTATGGCAAAGGG - Intergenic
971540629 4:27812008-27812030 CATCCTTTACTCTTGGGACAGGG + Intergenic
973159416 4:46996549-46996571 CATCAAGTTCTTATAGGCCATGG + Intronic
974111300 4:57528668-57528690 TTTCCTTTTCTTCTGGGACAGGG - Intergenic
975070967 4:70137485-70137507 CTTCCATTTCTCATGGGAACTGG - Intronic
980578978 4:134724112-134724134 CATTCATTTATTATTGAACAGGG - Intergenic
980818248 4:137977287-137977309 TGTCCATTTCTTATGTCACAAGG + Intergenic
981790964 4:148536037-148536059 CCTCCTTTTCTTTTGAGACAAGG + Intergenic
982984314 4:162185935-162185957 CATTCATTTTTCATGGGACTGGG - Intergenic
987856342 5:23424511-23424533 CCTCCATTCCTGATGGGGCATGG + Intergenic
988116633 5:26900876-26900898 CATCTATTTTTTAAAGGACAAGG - Intronic
991454612 5:66789005-66789027 CTTTCATTTCTTTTGGGAGAAGG - Intronic
991653380 5:68879129-68879151 CATTCATTTATTTTGAGACAGGG + Intergenic
994038125 5:95225956-95225978 CATCCATCTCTTAGGGAATAGGG - Intronic
994830790 5:104780898-104780920 AATACATTTCATATAGGACATGG + Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
995889511 5:116935020-116935042 CATCCATTAGTCATTGGACAGGG + Intergenic
1001848676 5:174943726-174943748 CAGCCATTTCTTCTTGGGCATGG - Intergenic
1002156453 5:177284771-177284793 CTTCCATATCTTATGGGTTATGG + Intronic
1004089345 6:12484550-12484572 CACCCATGTGTTATTGGACAGGG - Intergenic
1005310699 6:24556215-24556237 CTTCCATTTTTTTTGAGACAGGG + Intronic
1005598723 6:27405461-27405483 CTTCCATTCCTAATAGGACATGG - Intergenic
1005688200 6:28275804-28275826 CGTCCCTTTCTTATGGGCCCTGG + Intronic
1006108812 6:31732321-31732343 CATCCACTTCTTCTGGGAGGGGG + Exonic
1006145314 6:31955417-31955439 CATACATTTCTTATTTGACGTGG + Intronic
1006737669 6:36286061-36286083 CAATAATTTCTTATGTGACAAGG - Intronic
1008336365 6:50309225-50309247 CATCCATTTGTTATCTGACCAGG + Intergenic
1010408334 6:75531673-75531695 CATGCCTTTCTTATGGCAGAGGG - Intergenic
1012053533 6:94374709-94374731 CTTCCATTCTTTATGGGGCACGG + Intergenic
1012856524 6:104508387-104508409 CATCCTTTTCTTTTAGGACATGG - Intergenic
1017063856 6:150510459-150510481 CATTTATTTCTTTTTGGACAGGG + Intergenic
1018570730 6:165206891-165206913 CTGCCATTTCTTATGGCACAGGG - Intergenic
1021860272 7:24899111-24899133 CATCCATTTCTTATGGGACATGG + Intronic
1027055387 7:75046171-75046193 CATTCATTTGTTTAGGGACAGGG - Intronic
1028713542 7:93938346-93938368 TATCCCTTTCATATGGGAAAAGG - Intergenic
1029512933 7:101008130-101008152 CCTCCATTTCTTTTGAGATAGGG + Intronic
1033790900 7:144791369-144791391 CCTCCGGCTCTTATGGGACAGGG - Intronic
1034255151 7:149720684-149720706 CCTCTATATCTCATGGGACATGG + Intronic
1034485206 7:151356547-151356569 GATCCATCCCTTAGGGGACAAGG - Intronic
1036414830 8:8537394-8537416 CACACCTTTCTTATGGGAGATGG - Intergenic
1038544786 8:28417449-28417471 CATCCATTTCTTTTTTGAGATGG + Intronic
1038607130 8:29018680-29018702 CATCTACTTCCTATGGGACTAGG - Intronic
1039251884 8:35674996-35675018 CAACCATATCTAGTGGGACAGGG - Intronic
1044219857 8:89657370-89657392 AATACATTTCTTTTGGGAAATGG - Intergenic
1047347895 8:124046300-124046322 CATCCATTTCTTTTCAGCCAGGG - Intronic
1048156395 8:131958896-131958918 CATCCATTTCATAGGGTAAAAGG - Intronic
1048335646 8:133500255-133500277 CATCCATTATTGATGGGGCATGG - Intronic
1051521491 9:17993830-17993852 CATCCATCTCTTGTGGGATTTGG + Intergenic
1051931079 9:22386892-22386914 CATGCATGTCTTATGGCACATGG + Intergenic
1055093962 9:72390989-72391011 AGGCCATTTCTTTTGGGACAAGG - Intergenic
1056748422 9:89325643-89325665 CTTTCATTTCTTGTGGGAGAGGG - Exonic
1060304828 9:122402023-122402045 CATACACTTATTATGGGAAATGG + Intergenic
1186131991 X:6477964-6477986 CATCTGCTTCTCATGGGACATGG - Intergenic
1186552817 X:10524674-10524696 CATCCATTTCCTTGTGGACAGGG - Intronic
1187053192 X:15714568-15714590 CAGCCTTTTCCTATGGGAAAGGG - Intronic
1187187204 X:16998238-16998260 CATCCATTTTTTTTTAGACAGGG - Intronic
1188189017 X:27151373-27151395 CTCCCATTTCTTATGAGAAAAGG + Intergenic
1190448494 X:50554838-50554860 CATTGATTAGTTATGGGACATGG + Intergenic
1190457132 X:50637364-50637386 CATCAATTTCTTATTGGCAAGGG + Intronic
1192168400 X:68840144-68840166 CTTGCATTTCTTCAGGGACAGGG - Intronic
1192247499 X:69385972-69385994 CAACTATTTCTCATGGGACTTGG + Intergenic
1194508328 X:94761001-94761023 CATAAATTTATTATGGTACATGG + Intergenic
1195996215 X:110734144-110734166 AATCGATTTCTTCTGGGAAAAGG + Intronic
1199204138 X:145128034-145128056 CAACCTTTTCTTATGGGAAATGG + Intergenic