ID: 1021861889

View in Genome Browser
Species Human (GRCh38)
Location 7:24914055-24914077
Sequence CAGGGAAGCCCATTTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021861889_1021861894 -8 Left 1021861889 7:24914055-24914077 CCCACCACAAATGGGCTTCCCTG 0: 1
1: 0
2: 2
3: 23
4: 154
Right 1021861894 7:24914070-24914092 CTTCCCTGAGGGTTATCAACAGG No data
1021861889_1021861897 4 Left 1021861889 7:24914055-24914077 CCCACCACAAATGGGCTTCCCTG 0: 1
1: 0
2: 2
3: 23
4: 154
Right 1021861897 7:24914082-24914104 TTATCAACAGGATACCAACAAGG No data
1021861889_1021861898 12 Left 1021861889 7:24914055-24914077 CCCACCACAAATGGGCTTCCCTG 0: 1
1: 0
2: 2
3: 23
4: 154
Right 1021861898 7:24914090-24914112 AGGATACCAACAAGGCAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021861889 Original CRISPR CAGGGAAGCCCATTTGTGGT GGG (reversed) Intronic
900463168 1:2810990-2811012 CAGGGAATCCCATGAGTGGGAGG - Intergenic
900501686 1:3008880-3008902 CAGGCAAGCCCATGTGGGGCAGG + Intergenic
900962942 1:5937225-5937247 CAGGAAACCCCAGGTGTGGTGGG - Intronic
901132692 1:6972108-6972130 CAGGGAAGCCCCTTGTTGGGAGG - Intronic
902760925 1:18580375-18580397 CAGGAAAGCCCATTCATCGTCGG - Intergenic
903889206 1:26558445-26558467 CAGGGTGGCAGATTTGTGGTTGG + Intronic
905027767 1:34862941-34862963 CATGGAAGCACATGTGTGTTGGG - Intergenic
906103793 1:43279679-43279701 CAGGGCAGCTCCTCTGTGGTGGG + Intergenic
908384269 1:63626130-63626152 CAGGGGAGGCCATTTGAGGATGG + Intronic
913070172 1:115291613-115291635 CAGGGCAGCCCATCAGTGGCTGG - Intronic
915276034 1:154788834-154788856 CATAGCAGCCCTTTTGTGGTGGG + Intronic
915635530 1:157183948-157183970 CAGGGATTCCCAACTGTGGTAGG - Intergenic
915648514 1:157290860-157290882 CAGGGATTCCCAACTGTGGTAGG + Intergenic
918129422 1:181612326-181612348 CTGGGAAGTCAATTTGTGATTGG - Intronic
919633398 1:199980874-199980896 CAGGTAGGCCCATGTGTAGTGGG - Intergenic
923039852 1:230311871-230311893 CATGTATCCCCATTTGTGGTTGG + Intergenic
923817925 1:237401351-237401373 CTGGGGATCCCATTTGTGATTGG - Intronic
924879958 1:248150124-248150146 CTGTTAAGCCCATTTGTTGTGGG + Intergenic
1063904124 10:10765513-10765535 CAATAAAGCCCAATTGTGGTCGG - Intergenic
1067460158 10:46452290-46452312 CAGGGAGGCCCATCTGTGGGGGG - Intergenic
1067627032 10:47932313-47932335 CAGGGAGGCCCATCTGTGGGGGG + Intergenic
1068594466 10:58887999-58888021 AAGGGAAGCCCAATTCTAGTAGG - Intergenic
1072640026 10:97204945-97204967 CAGGGAAGCGCAATGCTGGTGGG + Intronic
1074116436 10:110460407-110460429 CAGGGATGCCCATTCCTGCTGGG - Intergenic
1075674023 10:124283398-124283420 CAGGTTAGCCCATTGGTGATAGG - Intergenic
1077279993 11:1739696-1739718 CAGGGAAGACCTTGTGGGGTGGG + Intronic
1078250889 11:9615378-9615400 CAGAGACTCCCATGTGTGGTTGG - Intergenic
1078456832 11:11482217-11482239 CTGGGAAGCCCATGTGCAGTCGG + Intronic
1079021981 11:16916793-16916815 CAGGGAAGAGCCTTTATGGTGGG - Intronic
1081718432 11:45268020-45268042 TAAAAAAGCCCATTTGTGGTTGG + Intronic
1081782729 11:45724342-45724364 CAGGGTAACCCATCTGTAGTAGG - Intergenic
1084462518 11:69303814-69303836 CAGCGAAGACCAGTGGTGGTCGG + Intronic
1088256924 11:107911738-107911760 AAGGGAATCTCTTTTGTGGTTGG - Intronic
1088815670 11:113419155-113419177 CAGGCAAGCCCTTCAGTGGTTGG + Intronic
1088896576 11:114083114-114083136 CACGGATGCCTTTTTGTGGTTGG + Intronic
1093363436 12:18261309-18261331 CAGAGAAGCTCATTTATGGTTGG + Intronic
1094243402 12:28256782-28256804 GAGGGAAGAACCTTTGTGGTAGG + Intronic
1096115842 12:49054564-49054586 CAGGGAAACCAATCTGTGATAGG + Exonic
1096633491 12:52944561-52944583 CAGGCAAGGCCATTCCTGGTGGG + Intronic
1096838156 12:54364373-54364395 CAGGTAAGCACTTTTGTTGTGGG - Exonic
1097949318 12:65409029-65409051 CAGAGAGGCCCATTTTTGGAAGG - Intronic
1097989631 12:65821891-65821913 CAGGTCAGCCCATTAGTGGGTGG - Intergenic
1098192618 12:67966513-67966535 CAGGAGAGCCCATCTGTGTTAGG - Intergenic
1099899463 12:88690129-88690151 CAAGGAACCACATATGTGGTAGG - Intergenic
1100326423 12:93543879-93543901 CTGGGGACCCCATTTGTGGCTGG + Intergenic
1102275846 12:111581350-111581372 CAGGGAAGACCAGCTGTGGTCGG - Intronic
1107664149 13:42671909-42671931 TAGAGAAGCCCTTTTGTGGCAGG - Intergenic
1110758959 13:79208686-79208708 CAGGGCAGCCCAGTGGTGGTGGG - Intergenic
1112710450 13:102121191-102121213 GTGAGAAGCCCATTTGTGGAAGG - Intronic
1113182483 13:107646047-107646069 CAGGGAAGCCCGTTTTTGTGAGG - Intronic
1113450501 13:110405930-110405952 CAATGAAGCGCATTTGTGGCTGG + Intronic
1114510040 14:23251355-23251377 CTGGGTACCCCATTTGTGGCTGG - Intronic
1115546959 14:34472501-34472523 CAGTAAAGCCCCTGTGTGGTGGG - Intergenic
1116976650 14:51123977-51123999 AAGGGAAGACCATTTCAGGTGGG + Intergenic
1119984669 14:79123811-79123833 CAGGTAAGCAAAGTTGTGGTTGG + Intronic
1120837552 14:89055039-89055061 CAAGGGTGCCCATTAGTGGTGGG + Intergenic
1121261767 14:92571646-92571668 CTGGGAAGCCCACTTGTGGCTGG - Intronic
1121419985 14:93806450-93806472 CAGGGAAGCCAAGATGTGGCTGG + Intergenic
1122203383 14:100136090-100136112 CAGGGAAGCCCATTTCTTATGGG + Intronic
1124008190 15:25811226-25811248 CAGGGAAGTCCGTTTCTGCTGGG - Intronic
1124122798 15:26905316-26905338 CATGGAAGCCCAGAGGTGGTGGG - Intronic
1126245951 15:46505884-46505906 CAAGGATACCCATTTGTGATTGG - Intergenic
1126333386 15:47558745-47558767 CAGGGAAACCCATTTATTGAAGG - Intronic
1126383027 15:48067451-48067473 CAGGGAAGTCCATGTGTACTCGG + Intergenic
1127297979 15:57626869-57626891 CTGCGATGCCCATTTCTGGTGGG + Intronic
1128285041 15:66429685-66429707 CAGGCTAGCCCATCTGTGTTGGG - Intronic
1129159100 15:73737339-73737361 CAGGTAGGCCCATTCCTGGTCGG + Exonic
1131060236 15:89399979-89400001 CGGGGAAGCCCATCTGAGCTGGG - Intergenic
1131544202 15:93302269-93302291 CAGGGCAGCCCACTGGTGATAGG + Intergenic
1135063438 16:19290039-19290061 CAGGGTAGTGCATTTGTGGGCGG + Intronic
1135839232 16:25859460-25859482 CAGGAAAGCACATATGTTGTAGG - Intronic
1137357162 16:47777951-47777973 CTGGGGACCCCATTTGTGGCTGG + Intergenic
1138192339 16:55024441-55024463 CTGTTAAGCCCATTTGTTGTAGG - Intergenic
1139884510 16:70198770-70198792 CAGTGAAGCCCAACTGTGGGAGG - Intergenic
1140368011 16:74396722-74396744 CAGTGAAGCCCAACTGTGGGAGG + Intergenic
1145854567 17:28141353-28141375 CAGTGTAGCTCATTTGTGGTTGG - Intronic
1146929681 17:36768414-36768436 CAGGGAAGCCACGGTGTGGTGGG + Intergenic
1147481980 17:40774605-40774627 CAGGGAAGCCATTTTGTGGGCGG - Intergenic
1149277579 17:55061013-55061035 CAGATAAGCCCACTTGTAGTTGG + Intronic
1149302439 17:55317764-55317786 CAGGGAAGATCATTTTTAGTGGG - Intronic
1150049445 17:61946364-61946386 CAGTGAAGGTCATTTGTGATGGG - Exonic
1153668210 18:7385239-7385261 CAGGAAAGCCAAGTTTTGGTGGG + Intergenic
1155880682 18:31144872-31144894 CAGGGAAGGCTATGTGTGTTGGG + Intronic
1156467392 18:37356491-37356513 CTGGGAAGGCCATTGGTGCTGGG + Intronic
1158736311 18:60085731-60085753 CAGGGCAGCACAGTGGTGGTGGG - Intergenic
1160766539 19:811133-811155 CAAGGAAGCCAAGTCGTGGTCGG - Exonic
1161281446 19:3447835-3447857 GAGGGAAGCCGATGTTTGGTGGG + Intronic
1162282373 19:9709509-9709531 CAGGGAAGAACAGTTGTGGCAGG - Intergenic
1163032592 19:14554074-14554096 CCTGGAGGCCCATGTGTGGTGGG + Intronic
1166908847 19:46136214-46136236 CAGGGATGCCAATATGTGGTAGG + Intergenic
926380268 2:12279886-12279908 CCTGGAACCCCATTTGTGATAGG + Intergenic
927004775 2:18836643-18836665 CAGGGAAGCTCATTAGAGGGAGG + Intergenic
928002134 2:27533051-27533073 CAGGGCAGTCCACTGGTGGTGGG + Intergenic
928232300 2:29509025-29509047 CAGGTATGCCCATCTGTGGACGG + Intronic
929364926 2:41142636-41142658 CAGAGAAGCACATTTGTCCTTGG - Intergenic
931009260 2:57889329-57889351 CAGGGAAGCCCATATGCAGTGGG - Intergenic
931268720 2:60683251-60683273 CAGGGAAGATCAGTTGTGGTCGG + Intergenic
937347836 2:121137790-121137812 CAAAGCAGCCCTTTTGTGGTTGG - Intergenic
939834655 2:147113806-147113828 CAGGGGACCCCTTTTTTGGTTGG - Intergenic
946168011 2:217877211-217877233 AAGGGAAGCCCGTTTATGGTGGG - Intronic
947742322 2:232490361-232490383 GACTGGAGCCCATTTGTGGTCGG + Intergenic
949028162 2:241775859-241775881 CAGGGAGGTCCATGTGTGCTCGG + Intergenic
1168790378 20:572181-572203 CAGGGAGGCCCAGTTATGTTGGG - Intergenic
1170560893 20:17557404-17557426 CAGAGAAGCCCCCTTGAGGTAGG - Intronic
1171073942 20:22103470-22103492 CAGGGTAGCCCATTAATGCTGGG + Intergenic
1173337235 20:42122656-42122678 CAGGGAAGCCAGCTAGTGGTTGG - Intronic
1174128487 20:48325865-48325887 CAGGGAAGCCCTTTGGCGGAGGG + Intergenic
1179028900 21:37702975-37702997 AAGGGAAGCCCATTTGAGATGGG + Intronic
1179268645 21:39829882-39829904 CTGTGAAGTCCATTTGTTGTAGG + Intergenic
1179269932 21:39842950-39842972 CAGGGAAACCCATGTGAGCTGGG - Intergenic
1180000586 21:44993669-44993691 CAGGGATGGCCATGTGTGTTGGG - Intergenic
1180378753 22:12118414-12118436 CAGGGTGGCCCACTAGTGGTTGG + Intergenic
1182790800 22:32951264-32951286 CAGGGAAGCCCTTTGGTGGTGGG - Intronic
953902654 3:46851973-46851995 CAGGGAACCACTTCTGTGGTGGG + Intergenic
956153563 3:66269105-66269127 CAGGTTTGCCCATTTGTGCTAGG + Intronic
960556864 3:119039566-119039588 TGGGGAATCCCATTTGTGGGGGG + Intronic
961489138 3:127240438-127240460 AAGGGTACCCCATTTGTGGCTGG - Intergenic
969061210 4:4436791-4436813 CAGTGAAGCCCATCAGTGGGAGG - Intronic
969351582 4:6601055-6601077 CCAGGAACCCCATTTGTGGCTGG - Intronic
970436000 4:16036384-16036406 GAGGGAACACCATTTGTGATGGG + Intronic
970964700 4:21914602-21914624 CAGGGAAGCGCTTTTTAGGTGGG - Intronic
972830502 4:42809437-42809459 TAGGGAATCCTATTTTTGGTTGG + Intergenic
973549102 4:52013725-52013747 CAGGAAAGCCCATTTGTGTAAGG - Intronic
973729324 4:53808474-53808496 CATGGAAGCCCATATGTAGTTGG - Intronic
973926543 4:55744225-55744247 CAGGGTGGCCCAGTAGTGGTGGG + Intergenic
974373496 4:61046693-61046715 AAGGGAATCCCATTTGTGTCAGG + Intergenic
977533238 4:98225036-98225058 CAGGGAAGTGCAGTGGTGGTGGG - Intergenic
979679536 4:123444465-123444487 CAGGGAGGCCCAGTGGTGGGGGG - Intergenic
979875828 4:125889946-125889968 CAGAGAATCCCATTTGTGATAGG + Intergenic
981434053 4:144699152-144699174 ATGGGCATCCCATTTGTGGTTGG - Intronic
981641308 4:146946283-146946305 CAGGAAAAGGCATTTGTGGTGGG - Intergenic
983715270 4:170775400-170775422 TGGGGAAACCCATTTGAGGTAGG + Intergenic
1202760370 4_GL000008v2_random:103884-103906 CAGGGTGGCCCACTAGTGGTTGG + Intergenic
986029874 5:3883867-3883889 CTGGGAAGCCCACATGGGGTAGG + Intergenic
990586262 5:57214287-57214309 CAGAGAAGTACATTTGTGGCTGG + Intronic
992500539 5:77338354-77338376 CAGGGAAGTCACTTTTTGGTGGG + Intronic
996188197 5:120505421-120505443 TTGGGAAGTCCATTTGTGATTGG - Intronic
999200050 5:149809871-149809893 CAGGGAGGCCCATCTGGGGAGGG + Intronic
1000096758 5:157978147-157978169 CAGGGCAGCCCTTTTGTTGAAGG - Intergenic
1000342435 5:160287981-160288003 CAGGGAAGCCCATCTGCCGCAGG + Intronic
1000625549 5:163534084-163534106 CAGGAAAACCCAATTGTTGTTGG + Intergenic
1002613276 5:180435356-180435378 CAGGGAACCCCACTTGGGGCTGG + Intergenic
1003005769 6:2380125-2380147 GAGTGAAGCCCACTTGTGATGGG - Intergenic
1004260764 6:14105652-14105674 CAGGCTAGCCCATTTGTGCCAGG - Intergenic
1006811892 6:36825459-36825481 CAGGGAGGCCCAGTTGGGGGTGG - Intronic
1010235204 6:73569391-73569413 CATGGAAGCCCAGCTGTGTTTGG + Intergenic
1011189149 6:84712479-84712501 CAGGGAAACCCAAGTGTTGTTGG + Intronic
1012486435 6:99726613-99726635 CTGGGAAGCACAGTTGTAGTTGG + Intergenic
1017687465 6:156927935-156927957 AAGAGGAGCCCATTTGAGGTTGG + Intronic
1018472615 6:164109949-164109971 CAGGAACGCCCTCTTGTGGTTGG + Intergenic
1021745587 7:23738063-23738085 CTGGGGACCCCATTTGTGGCTGG - Intronic
1021861889 7:24914055-24914077 CAGGGAAGCCCATTTGTGGTGGG - Intronic
1027502520 7:78970951-78970973 CAGGGAAGCCCTTTAGTTTTGGG + Intronic
1028502100 7:91530144-91530166 CTGTTAAGCCCATTTGTTGTAGG - Intergenic
1028788742 7:94828247-94828269 CAAAAAAGCCCATTTTTGGTTGG - Intergenic
1028822755 7:95231384-95231406 CTGTGAAGTCCATTTGTTGTAGG - Intronic
1033301718 7:140192247-140192269 AGGGGAAGCACATTTGTTGTGGG - Intergenic
1039899499 8:41741084-41741106 GAGGGAAGCCCAGTTCTGGGTGG - Intronic
1040701256 8:50068655-50068677 AATGGATGCCCAATTGTGGTAGG + Intronic
1041942953 8:63409036-63409058 CAGGGAAGACCAGCTGTGGTCGG - Intergenic
1042965469 8:74347202-74347224 CTGGGAAGCCTATCTGTGTTAGG + Intronic
1043288393 8:78564257-78564279 CTTGGAAGCCCATTTGTGGTTGG + Intronic
1045934688 8:107665037-107665059 CTGGGAATCCCATATGGGGTTGG - Intergenic
1046647371 8:116800893-116800915 CAGGGAACCCCATCTGGGGTTGG + Intronic
1048969528 8:139637252-139637274 CAAGGAAGCCTATGTGTGTTGGG - Intronic
1050540417 9:6664792-6664814 CAGGTCAGCCCATTTGTGCAAGG + Intergenic
1053561068 9:39194621-39194643 CAGGGACACCCATTGGTGGTTGG - Intronic
1053825166 9:42014866-42014888 CAGGGACACCCATTGGTGGTTGG - Intronic
1054136051 9:61424336-61424358 CAGGGACACCCATTGGTGGTTGG + Intergenic
1054605401 9:67172495-67172517 CAGGGACACCCATTGGTGGTTGG + Intergenic
1058611166 9:106777206-106777228 CAGGGAAGCCCATGTAGGGAAGG - Intergenic
1059247216 9:112858731-112858753 CAGAGAAGCCCAGGGGTGGTAGG - Intronic
1203541145 Un_KI270743v1:88777-88799 CAGGGTGGCCCACTAGTGGTTGG + Intergenic
1187071025 X:15888398-15888420 TAGGGCAGGGCATTTGTGGTGGG + Intergenic
1192819278 X:74626483-74626505 CAGGGAAGACATTTTTTGGTGGG + Intergenic
1195544719 X:106101434-106101456 CTGGGTACCCCATTTGTGGCTGG - Intergenic
1196542332 X:116924355-116924377 TAGGAAAGCCCATTTGTAGCAGG + Intergenic
1196650856 X:118166730-118166752 CTGAGAATCCCATTTGTGGCTGG + Intergenic
1197081535 X:122424241-122424263 CAGTTAAGTCCATTTGTTGTAGG + Intergenic
1198875120 X:141216373-141216395 TATGGAAGCCCATTTTTGATAGG + Intergenic