ID: 1021862228

View in Genome Browser
Species Human (GRCh38)
Location 7:24917207-24917229
Sequence ATGGAGAACAAGGAAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1084
Summary {0: 1, 1: 0, 2: 2, 3: 74, 4: 1007}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021862228 Original CRISPR ATGGAGAACAAGGAAGAGGC AGG (reversed) Intronic
900010805 1:106029-106051 ATGGAGAACAAAGAGCAAGCTGG + Intergenic
900026907 1:282593-282615 ATGGAGAACAAAGAGCAAGCTGG + Intergenic
900523619 1:3117747-3117769 CTGGAGCACAAGGACAAGGCGGG - Intronic
900752969 1:4410894-4410916 AAGAAGAACCAGGAAGATGCGGG - Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
902040091 1:13486208-13486230 ATGGAGACAGAGGGAGAGGCTGG - Intronic
902242237 1:15096715-15096737 ATGGGGAAGAAGGAAGAGGGAGG + Intronic
902392514 1:16114828-16114850 ATATGGAACAAGGCAGAGGCGGG + Intergenic
902562884 1:17288883-17288905 GTGGGGAACAGGGAAAAGGCAGG + Intergenic
902990573 1:20184855-20184877 ATTGAGAAGAAAGGAGAGGCTGG + Intergenic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
904295757 1:29518833-29518855 AAGGAGGAGAAGGAAGAAGCAGG - Intergenic
904331352 1:29759547-29759569 ATGGAGATCAAGTGAGAGGGTGG - Intergenic
904420277 1:30386686-30386708 GTGCAGAACAAGGAAGATGGGGG + Intergenic
904999871 1:34659669-34659691 AGAGAGCACAAGAAAGAGGCAGG - Intergenic
905106095 1:35564464-35564486 ATGGGGCACAGGGAACAGGCAGG - Intronic
906584321 1:46963076-46963098 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
906593996 1:47056744-47056766 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
906650668 1:47510276-47510298 AAGGAGCCCAAGGAAGACGCTGG + Intergenic
906673918 1:47679500-47679522 TTGGAGACACAGGAAGAGGCAGG - Intergenic
906933813 1:50194639-50194661 CTGGAGACCAAGAAAGAAGCAGG + Intronic
906975610 1:50569025-50569047 ATGGTGAACAAGAAAGACTCGGG + Intronic
907190741 1:52645928-52645950 TTGGAAAACAAAGAAGAGGAGGG + Intronic
907686958 1:56621431-56621453 ATGAAGCACAAGGAAAAGACAGG + Intronic
907719735 1:56960596-56960618 TAGGGAAACAAGGAAGAGGCTGG + Intronic
907737663 1:57130601-57130623 TTGGAGAACATGGACGAGCCTGG + Intronic
907743048 1:57185484-57185506 AGGGAGAAAAAGAGAGAGGCAGG + Intronic
907780954 1:57565592-57565614 ATGGAAAACAAAAAAAAGGCAGG + Intronic
908088348 1:60660631-60660653 TTGGAGAACAAAGAGGAGTCTGG - Intergenic
908308170 1:62846831-62846853 ATTGAGAACCAGCTAGAGGCAGG - Intronic
908324661 1:63012049-63012071 ATGGAGAGGTAGGAAGAGGGAGG - Intergenic
910032490 1:82745732-82745754 AGGGAGAGAAAGGAAGAGGAGGG - Intergenic
910991235 1:93058730-93058752 ATGGAGGTAAAGGAGGAGGCTGG + Intergenic
911141774 1:94510814-94510836 ATGGAAAACAAAAAAAAGGCAGG - Intronic
911185856 1:94904452-94904474 ATGGAGAACACAGCTGAGGCAGG + Intronic
911735325 1:101330718-101330740 ATAGAGAACAAGGTAAAGGATGG + Intergenic
912707402 1:111925101-111925123 AGGGAGGACAAAGAAGAAGCTGG + Intronic
913070577 1:115294824-115294846 CTGGAGAGCCAGGAAGAGCCAGG + Intronic
913181698 1:116328774-116328796 ATGGGGACAAAGGAAGAGGAAGG + Intergenic
913641784 1:120819302-120819324 ATGGAAAACAAAAAAAAGGCAGG - Intronic
913710648 1:121479404-121479426 ATGGAAAACAAAAAATAGGCAGG + Intergenic
914258178 1:145977370-145977392 AAGGAGAGGAAGGAAGGGGCTGG - Intronic
914964655 1:152244181-152244203 ATGGAGAAGAAGGAGAAGGGAGG - Intergenic
915177389 1:154027474-154027496 AGGGAGAATAAGGAAGTGCCAGG - Intronic
915183049 1:154080061-154080083 ACACAGAAGAAGGAAGAGGCTGG + Intronic
915575400 1:156772978-156773000 ATGGAAAACATGGAAGAGCCTGG + Intronic
915763453 1:158338386-158338408 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
916142030 1:161708262-161708284 ATGAAAAAGAAGGAAGAGTCTGG - Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916349440 1:163832329-163832351 ATGGAGAACTAGAAAGAGAAAGG + Intergenic
916712470 1:167424211-167424233 TTGGAGAACATGGAACAGGTTGG + Exonic
916770921 1:167907166-167907188 ATGGAGAACAAGAGATGGGCTGG + Intronic
917682839 1:177385097-177385119 ATGGAGAGCAAGGAAAAGCAGGG - Intergenic
917686328 1:177419766-177419788 AAGGAGAACAGGGCAGAGGAGGG - Intergenic
917699512 1:177565907-177565929 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
917710042 1:177675626-177675648 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
918323635 1:183388984-183389006 ATGGAGCACAAGGAAAAGAAAGG + Intronic
918974335 1:191462583-191462605 AAGTAGAATAAGGAAGAAGCAGG - Intergenic
919178975 1:194057558-194057580 CTGGAGAGCAAGGACGGGGCTGG - Intergenic
919442104 1:197648638-197648660 AAGGAGAATAAAGAAGAGCCTGG - Intronic
919775330 1:201190726-201190748 CTGGAGGAGAAGGAGGAGGCGGG + Intergenic
920631985 1:207661468-207661490 ATGGAAAACAAAAAAAAGGCAGG - Intronic
920813496 1:209308921-209308943 TTGCAGGACTAGGAAGAGGCTGG - Intergenic
920890107 1:209977029-209977051 ATGGAAAACAAAAAAAAGGCAGG - Intronic
921388068 1:214590624-214590646 ATGGAGAACATGGGAGAGATGGG + Intergenic
921547332 1:216487765-216487787 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
921824359 1:219655450-219655472 ATGGAAATTAAGCAAGAGGCAGG - Intergenic
922240834 1:223754750-223754772 ACGCAGAACAAGAAAGAGTCTGG + Intronic
922259248 1:223922035-223922057 ATGGAGAACAAAGAGCAAGCTGG + Intergenic
922327962 1:224546567-224546589 GTGGAGAACAAAGAAAAGGGAGG + Intronic
923013281 1:230105835-230105857 ATGGACAACTAGGAAGTGGTGGG + Intronic
923199340 1:231696128-231696150 ATGTGGAACAAGGGAGAGGGAGG - Intronic
923319008 1:232811416-232811438 TTGGAAAACAAGGAAAATGCTGG + Intergenic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
923773260 1:236956397-236956419 ATGGAGAGAAAGGAAGAAACAGG - Intergenic
923825117 1:237491726-237491748 ATGTAGAAAAAGGAAGACACTGG + Intronic
924171052 1:241341545-241341567 AAGGAGAAGAAGGAAAAGGAAGG + Intronic
924238095 1:242015795-242015817 ATGGAGAAAAAGGGGAAGGCAGG + Intergenic
924278676 1:242413721-242413743 ATGGAAAGGTAGGAAGAGGCAGG + Intronic
924340433 1:243024782-243024804 ATGGAGAACAAAGAGCAAGCTGG + Intergenic
924414806 1:243849189-243849211 GAGGTGGACAAGGAAGAGGCTGG + Intronic
924639374 1:245818713-245818735 ATGGAAAACAAAAAAAAGGCAGG + Intronic
924952354 1:248896782-248896804 ATGGAGAGCAAGGAAAAGCAAGG + Intergenic
1062859494 10:799393-799415 ATGGAAAACAAAGAAGAGCAGGG + Intergenic
1063336995 10:5224992-5225014 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1063384684 10:5608696-5608718 ATGGAGGTCAAGGAAGGGGAAGG + Intergenic
1063889876 10:10618302-10618324 AGGGAGAGTAGGGAAGAGGCTGG - Intergenic
1064819890 10:19316784-19316806 ATGGGGAGCAAGGCAGAGGTGGG + Intronic
1065268113 10:23998429-23998451 ATTGAGAGCAAGAGAGAGGCAGG - Intronic
1065476191 10:26140385-26140407 ATGAAAAACAAGGGAGAGGCTGG + Intronic
1065965452 10:30766899-30766921 ATGGAGGAGAACGAGGAGGCGGG - Intergenic
1066163206 10:32756919-32756941 ATGGAAAACAAAGAAAAAGCAGG + Intronic
1066291935 10:34022359-34022381 AGGGAGGGCAAGGACGAGGCTGG + Intergenic
1066677124 10:37899153-37899175 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1066687870 10:37997617-37997639 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1066736066 10:38480818-38480840 ATGGAGAACAAAGAGCAAGCTGG - Intergenic
1066933829 10:41801702-41801724 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1066984798 10:42455258-42455280 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067035295 10:42911306-42911328 TTGGAGATCAAGGAAAAGGGTGG + Intergenic
1067128146 10:43537772-43537794 AGGAAGAAGAAGGAAGAGGAAGG - Intergenic
1067336006 10:45364331-45364353 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1067370495 10:45677909-45677931 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067389285 10:45848247-45848269 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067416785 10:46108711-46108733 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067444971 10:46336302-46336324 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067502184 10:46815594-46815616 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067592401 10:47524426-47524448 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067639517 10:48032499-48032521 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067873978 10:49987806-49987828 ATGGAGAAGGAGGTGGAGGCAGG + Intronic
1067950664 10:50734723-50734745 ATTAAGAACAGGGAAGTGGCTGG - Intergenic
1067987496 10:51165714-51165736 ATGGAAAACAAAAAAAAGGCAGG + Intronic
1068766094 10:60765422-60765444 AAGGAGGAGAAGGAAGAGGAAGG + Intergenic
1069337776 10:67373292-67373314 ATGGAAAACAAAAAAAAGGCAGG + Intronic
1069987282 10:72293009-72293031 ATGAAGAACAGGGAAGAACCAGG + Intergenic
1070136502 10:73698649-73698671 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1070419186 10:76219433-76219455 ATGGAAAACAAAAAAAAGGCAGG + Intronic
1070523247 10:77273217-77273239 AGGGAGAATAAGAGAGAGGCAGG - Intronic
1070653629 10:78255702-78255724 ATGGAAAAGCAGTAAGAGGCTGG - Intergenic
1070740824 10:78902147-78902169 TGGGAGACCTAGGAAGAGGCAGG - Intergenic
1070886007 10:79899920-79899942 ATTAAGAACAGGGAAGTGGCTGG - Intergenic
1070902931 10:80046718-80046740 ATGTAGAAGAAGGAAGGGGAAGG + Intergenic
1070970689 10:80564769-80564791 ATGGAGAACATGGAAGAAAGAGG - Intronic
1071063536 10:81602831-81602853 ATGGAAAACAAGGAAGAGAGAGG + Intergenic
1071074806 10:81737250-81737272 ATGGAAAACAAAGAAAAGTCAGG + Intergenic
1071370725 10:84948895-84948917 GTGAAAGACAAGGAAGAGGCAGG - Intergenic
1071981955 10:91012385-91012407 ATGGAGGAGAAGGAAAAGGCAGG + Intergenic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1073661240 10:105478824-105478846 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1074012801 10:109500551-109500573 TTCCAGAACAAGGAAAAGGCTGG + Intergenic
1074214339 10:111369619-111369641 ATGGAAAACAAGGGAGAGAAGGG - Intergenic
1074278271 10:112025433-112025455 ACGGAGGACCAGGAAGAGACAGG + Intergenic
1074874269 10:117602179-117602201 ATGGAGAAAAGGGAAGGGGGTGG + Intergenic
1074910570 10:117904986-117905008 ATGGTGGAGTAGGAAGAGGCTGG + Intergenic
1075183939 10:120238126-120238148 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1075498282 10:122947440-122947462 ATGCAGAACTAAGAAGAGGCAGG + Intronic
1075854427 10:125617109-125617131 ATGGAAAACAAAAAAAAGGCAGG - Intronic
1076109674 10:127851108-127851130 GTGGAGAAGGAGGGAGAGGCAGG + Intergenic
1076161654 10:128248257-128248279 ATGGAGTAGGAGGAAGAGCCTGG + Intergenic
1076264639 10:129100086-129100108 AAGGAACACCAGGAAGAGGCAGG + Intergenic
1076372582 10:129964762-129964784 AAGGAGAAGTGGGAAGAGGCAGG + Intergenic
1076444588 10:130504017-130504039 ATTGATAACAAGGAAGAACCTGG - Intergenic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077225273 11:1436785-1436807 ATGGAGAGGAAGGGAGAGGAGGG - Intronic
1077599490 11:3564099-3564121 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1077768081 11:5182889-5182911 ATGGAAAACAAAAAAAAGGCAGG + Intronic
1077915550 11:6609358-6609380 CTGGAGTACAAGGAAGAGCAGGG + Exonic
1077992395 11:7423710-7423732 ATGGAGAATAAGAGAAAGGCCGG + Intronic
1078691138 11:13582122-13582144 ATGGAGAGCAAGGAAAAGCAGGG + Intergenic
1078714133 11:13823833-13823855 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1078810937 11:14762411-14762433 ATTAAGAAAAAGGAAGATGCAGG + Intronic
1078873121 11:15367425-15367447 CAGGAGATCAAAGAAGAGGCGGG + Intergenic
1078948492 11:16099991-16100013 AAAGAGAACAAGGACAAGGCAGG + Intronic
1079651342 11:22933758-22933780 ATAAAGAAAAAAGAAGAGGCCGG - Intergenic
1079748913 11:24170153-24170175 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1080679986 11:34465803-34465825 ATGGAGAACATTGAAAAGGTAGG + Intronic
1081006238 11:37746830-37746852 GGGTAGAAGAAGGAAGAGGCAGG + Intergenic
1082136710 11:48557395-48557417 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1082596375 11:55086688-55086710 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1082638241 11:55622959-55622981 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1082993841 11:59233395-59233417 ATGGAGAGCAAGGAAAAGCAGGG + Intergenic
1083225167 11:61280571-61280593 GTGCAGAGAAAGGAAGAGGCAGG + Intronic
1083334052 11:61912631-61912653 ATGCACAGCAAGGAAGTGGCAGG + Intronic
1084255396 11:67938704-67938726 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1084459488 11:69288451-69288473 ATGGGGCCCAAGGGAGAGGCTGG - Intergenic
1084581990 11:70029844-70029866 GTGAAGACCGAGGAAGAGGCTGG - Intergenic
1084742730 11:71149993-71150015 ATGGAGAGGAAGGGAGAGGAAGG + Intronic
1084817353 11:71656591-71656613 AGGCAGAACAAGGAAAAGGATGG - Intergenic
1084920640 11:72466813-72466835 ATGAAGAACAAGAACAAGGCTGG + Intergenic
1085049218 11:73371372-73371394 ATGGGGAAAGAGGAAAAGGCAGG + Intergenic
1085221849 11:74881286-74881308 ATGGAAAACAAAAAAAAGGCAGG - Intronic
1085224848 11:74910586-74910608 ATGGAGAAGCAGGCAGAGTCAGG + Intronic
1085322924 11:75585589-75585611 GTGGAAAACTAGGACGAGGCAGG - Intergenic
1085565714 11:77511890-77511912 ATGCATAACAAGGAAGGGGTTGG + Intergenic
1085654214 11:78297661-78297683 AAGTAGAACAAGCAAAAGGCAGG + Intronic
1085807658 11:79651052-79651074 AAGGAGAAGAAGGAAGATGGAGG - Intergenic
1086196998 11:84152680-84152702 ATAGAAAACAAAAAAGAGGCCGG - Intronic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1086971109 11:93082062-93082084 TTGGAGAGCATGGAAGAGGCAGG - Intergenic
1087062423 11:93993255-93993277 ATGGCGAACAGGGAAAAGGAGGG - Intergenic
1087451382 11:98328723-98328745 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1088058292 11:105611207-105611229 AAGGAGAGAAAGGAAGAGGAGGG - Intronic
1088517593 11:110655661-110655683 TTAGTGATCAAGGAAGAGGCAGG + Intronic
1089538294 11:119173953-119173975 ATGGAGCACAAAGAGGAGGTGGG - Exonic
1089623367 11:119735623-119735645 ATGGCCCACAAGGGAGAGGCTGG - Intergenic
1089707501 11:120290406-120290428 ATGTAGTACACAGAAGAGGCTGG + Intronic
1089737464 11:120559811-120559833 ACGCAGAACACAGAAGAGGCAGG - Intronic
1089754678 11:120677996-120678018 ATGCAGAACATGGAAGATGCTGG + Intronic
1089925009 11:122248197-122248219 ATAGAGAAGAAATAAGAGGCAGG + Intergenic
1090007730 11:123017639-123017661 ATGGTGGAGAAGGAGGAGGCTGG + Intergenic
1090444039 11:126748246-126748268 AGGGAGTAAAAGGAAGTGGCTGG - Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090672998 11:128963486-128963508 AAAGAGAAAAAGGAAGAGGAGGG + Intergenic
1090996069 11:131866981-131867003 ATGGAGAACAGGGAGGAGGTGGG + Intronic
1091299196 11:134496092-134496114 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1091326339 11:134691392-134691414 ATGGAGAGGAAGGGAGAGGAGGG - Intergenic
1091366610 11:135026797-135026819 ATGGAGAAGAAGGTAGAGAAAGG - Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1092417768 12:8304887-8304909 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1092425631 12:8373444-8373466 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1092530308 12:9338578-9338600 CTGGAGGACAAGGAAGGGGAGGG + Intergenic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1092826024 12:12399463-12399485 AGAGAGGACAGGGAAGAGGCAGG + Intronic
1093179056 12:15947531-15947553 ATGGAAAACAATAAAAAGGCAGG - Intronic
1093235958 12:16608612-16608634 TTGGGGAAAAAGGAAGAGGATGG - Intronic
1093405476 12:18799116-18799138 ATGTAAAACAAGAAAGGGGCAGG + Intergenic
1093499791 12:19798727-19798749 AAAGAGAACAAGGAAGAGGGAGG - Intergenic
1093579576 12:20771262-20771284 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1093725909 12:22508339-22508361 AGGGAAAATAAGGAAGAGGATGG + Intronic
1094222237 12:28006845-28006867 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1094469027 12:30785580-30785602 AAGGAGAAAAAAAAAGAGGCTGG + Intergenic
1094862067 12:34478610-34478632 ATGGAAAACAAAAAAAAGGCCGG + Intergenic
1095059354 12:37664413-37664435 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1095083519 12:38033729-38033751 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1095218472 12:39578706-39578728 ATTGAGAAAAATTAAGAGGCAGG - Intronic
1095541481 12:43313339-43313361 TTGAAGAAAAAGGAAGAGGAGGG - Intergenic
1096106161 12:48998056-48998078 AGGGCGCACAAAGAAGAGGCTGG - Exonic
1096775118 12:53959012-53959034 GTGGAGAACAGCTAAGAGGCTGG - Intergenic
1097078690 12:56413532-56413554 AGGGAGAGCCAGGAACAGGCAGG - Intergenic
1097176951 12:57148838-57148860 ATGGGGAAGAAGGAGGTGGCTGG + Intronic
1097531935 12:60812399-60812421 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1097564258 12:61248717-61248739 GTGGAGGAGAAGGAAGAGGAGGG - Intergenic
1098191672 12:67955674-67955696 ATGGATATAAAGGAAGAGGAAGG - Intergenic
1098449293 12:70601295-70601317 ACGGAAAATAAGGAAGAGGCGGG - Intronic
1098726951 12:73980049-73980071 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1098923225 12:76321806-76321828 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099310335 12:81012565-81012587 TTGAAGAAAAAGGTAGAGGCGGG + Intronic
1099730231 12:86490730-86490752 ATGGAAAACAAAAAAAAGGCAGG + Intronic
1100446563 12:94666001-94666023 ATGGAGAAGCAGGGAAAGGCTGG - Intergenic
1101423371 12:104567462-104567484 AAGGAAATAAAGGAAGAGGCAGG - Intronic
1101827301 12:108230686-108230708 ATGCAGAACAGGGAAGACCCTGG + Intronic
1102119627 12:110429993-110430015 CTGGAGAAGTAGGAAGAGGAGGG - Intergenic
1102167991 12:110821209-110821231 TTTGAGAAGAAAGAAGAGGCTGG - Intergenic
1102178449 12:110893502-110893524 ATTGAGAACAGGGCACAGGCAGG - Intronic
1102409517 12:112705154-112705176 AGGGAGAAAAAGGAAAAGGTAGG + Intronic
1102453605 12:113057830-113057852 AGAGACAACACGGAAGAGGCTGG + Exonic
1102703655 12:114862460-114862482 AGGGAAAACAAGGTAGGGGCTGG + Intergenic
1102739961 12:115198353-115198375 ATGGACAAAATGGAAGAGGGGGG + Intergenic
1102901116 12:116637967-116637989 ATAGAGAATAGGGAAGAGGTGGG + Intergenic
1102925809 12:116825270-116825292 AGGGAGAACAAGCAAAAGGAAGG + Intronic
1103022988 12:117551309-117551331 AAAGAGGAGAAGGAAGAGGCAGG - Intronic
1103361984 12:120359937-120359959 AAGGAGAGTAGGGAAGAGGCTGG - Intronic
1104080738 12:125428577-125428599 ACGGAGAAAAAGGAAGATGGAGG - Intronic
1104333315 12:127868035-127868057 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1104474459 12:129059724-129059746 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1104475433 12:129067080-129067102 AGGGGGAACAAAGAAGAGCCTGG + Intergenic
1104754861 12:131262616-131262638 AGGGAGAAGAAGGAAGAGAGAGG + Intergenic
1105782086 13:23714527-23714549 ATGGAGGGCAAGAAAGAGGGTGG - Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1107245400 13:38288002-38288024 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1107275646 13:38675926-38675948 ATGGATATAAAGGAAGAGGAAGG + Intergenic
1107508355 13:41058309-41058331 AGGGGGAACAAGTATGAGGCTGG - Intronic
1107902990 13:45036399-45036421 ATGCAGAACATTGAAAAGGCAGG + Intronic
1108414498 13:50184125-50184147 ATGGAAAACAAAAAAAAGGCAGG - Intronic
1108592445 13:51923659-51923681 ATGGAAAAAAAGGAAGATGAAGG + Intergenic
1108892969 13:55284796-55284818 AAGGAGAAGAAAGAAGAAGCAGG + Intergenic
1109078583 13:57868495-57868517 ATGGAGAACAAAGAAGAGCAGGG + Intergenic
1110754174 13:79152300-79152322 TTGGAGAAAAAGGAGGAGGGTGG - Intergenic
1110912922 13:80985956-80985978 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1111044458 13:82796543-82796565 AAGAAAAACAAGGAAGAGGTAGG + Intergenic
1111797935 13:92946863-92946885 AAGGAGGAAAAGGAAGAGGGAGG + Intergenic
1111999030 13:95193132-95193154 ATGTAGAGAAAGGAAGAGTCTGG + Intronic
1112239858 13:97671237-97671259 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1112383761 13:98918793-98918815 AAGTAGAACAAGAAAGAGGAAGG + Intronic
1112444933 13:99455433-99455455 ATGGAGATAGATGAAGAGGCAGG - Intergenic
1112835190 13:103506329-103506351 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1113121083 13:106924569-106924591 AGGGAGAACTAGGAAGAAGGAGG + Intergenic
1113639917 13:111949856-111949878 ATGGGGAAGAAGGATGAGCCAGG + Intergenic
1113978040 13:114246616-114246638 ACAGAGAGCAAGGAAGAGCCAGG + Intronic
1114197986 14:20495714-20495736 AGGGAGAGGAAGGAAGAGGAGGG - Intergenic
1114616481 14:24071444-24071466 AGGGAGAAGAGGGAAGGGGCAGG - Intronic
1114685624 14:24528243-24528265 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1115573168 14:34686236-34686258 GTGGAGAACAAGCAGGAGGTGGG + Intergenic
1115934282 14:38534148-38534170 ATGAAGACCAAGGCAGAGACTGG + Intergenic
1116026826 14:39525381-39525403 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1116674367 14:47886815-47886837 AGGGAGACAAAGGAAGAGGAAGG + Intergenic
1116675721 14:47903359-47903381 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1116801478 14:49448938-49448960 ATAGAGCAAAAGGAAGAGCCAGG - Intergenic
1117099598 14:52332992-52333014 ATTGAAAACACAGAAGAGGCCGG - Intergenic
1117104766 14:52386473-52386495 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1117636895 14:57753734-57753756 GTGGAGAATCAGGAAGAGGTTGG - Intronic
1117646749 14:57861170-57861192 GTGGAGGACATGGTAGAGGCTGG - Intronic
1117811706 14:59553782-59553804 ATGGAAAACAAAAAAAAGGCAGG + Intronic
1118489856 14:66248430-66248452 GTGGAGAAAAAGGGAGAGGAAGG + Intergenic
1118767721 14:68921322-68921344 AAGCAGAAGAAAGAAGAGGCAGG - Intronic
1118860073 14:69656109-69656131 ATGGAGGAAGAGGAAGAGGAAGG - Intronic
1119616669 14:76103319-76103341 GTGCAGAACAGGGAGGAGGCTGG - Intergenic
1120037333 14:79712821-79712843 ATGACGAGCAAGGAAGACGCAGG - Intronic
1120084093 14:80249509-80249531 ATGGAAAACAAAAAAAAGGCAGG - Intronic
1120147411 14:80994042-80994064 AAGGAGGAAAAGGAAGAGGAGGG - Intronic
1120925332 14:89792298-89792320 AAGGGGAATAAGGAAAAGGCAGG + Intergenic
1121114696 14:91335456-91335478 AGGGAGAGCCAGGCAGAGGCAGG - Intronic
1121312164 14:92941071-92941093 AGGAAAAACAAGGAAGGGGCAGG + Exonic
1121631685 14:95425670-95425692 ATGGGGAAGATGGAGGAGGCTGG + Intronic
1122261736 14:100527496-100527518 ACTGAGAACAAGGAAAAGGCAGG - Intronic
1122697129 14:103561656-103561678 ATGGAGAGAAACGAAGAAGCGGG - Intronic
1122876387 14:104667875-104667897 ATAAAGATCAAGGAAGAGACTGG - Intergenic
1123780815 15:23626419-23626441 ATGGAAAACAAAAAAGGGGCAGG - Intronic
1124091773 15:26611113-26611135 ATGGCGAACAAGGAAGTAACTGG + Intronic
1124373316 15:29115554-29115576 CGGGAGAACGGGGAAGAGGCAGG + Intronic
1124463111 15:29911347-29911369 CAGCAGAAGAAGGAAGAGGCAGG + Intronic
1124797785 15:32799258-32799280 ATGAAGAGCAGGGAAGAGACGGG - Intronic
1124848156 15:33311293-33311315 TAGGGGAACAAGGGAGAGGCAGG - Intronic
1125228965 15:37429332-37429354 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1125697844 15:41653839-41653861 ATGGTGGCAAAGGAAGAGGCAGG - Intronic
1126052331 15:44697311-44697333 AAGGAGAAGAAGGAAGAAGAAGG - Intronic
1126196397 15:45936649-45936671 ATGGAGAAATAGTAGGAGGCAGG - Intergenic
1126284341 15:46994608-46994630 ATGGAAAACAAGAAAAAAGCAGG - Intergenic
1126403315 15:48296647-48296669 ATGAGGAACAAGGATGAGGAAGG + Intronic
1126567640 15:50116293-50116315 ATGCAGAACAAGGAGGAATCTGG + Intronic
1127129177 15:55844177-55844199 AAGGAGAAGAAGGGAGAGGAAGG + Intronic
1127244284 15:57154444-57154466 TTAGGGAACAAGGAATAGGCAGG + Intronic
1127453330 15:59137221-59137243 ATGGAGGACACTGAAAAGGCTGG - Exonic
1127775699 15:62262686-62262708 ATGGAGAACAAAGAAAGGGAGGG + Intergenic
1127791989 15:62406290-62406312 AGGGACAACAATGAAGAGACGGG - Intronic
1127811614 15:62570009-62570031 ATAGAGAAGAAGGAAGAGAGAGG - Intronic
1128389790 15:67175110-67175132 ATGGAGGGGAAGGAGGAGGCAGG + Intronic
1128580893 15:68808959-68808981 GTGGGGAACAAGTAAGAGGCAGG - Intronic
1128648421 15:69393605-69393627 ATGGAGCAGGAGGGAGAGGCAGG - Intronic
1128762403 15:70226220-70226242 GTGGAGAAAATGGAACAGGCTGG + Intergenic
1128941371 15:71790486-71790508 ATGAAGAACAGGCAAGAGGAAGG + Intergenic
1129914999 15:79260974-79260996 AGGGAGGACTAGGGAGAGGCTGG + Intergenic
1130475978 15:84267923-84267945 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1130483399 15:84381977-84381999 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1130863187 15:87909169-87909191 ATGGACAGCAAGGAGGAGGAGGG - Intronic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1131651929 15:94409714-94409736 ATGGAGAAGAGGGAAGAGAGAGG - Intronic
1131673276 15:94645092-94645114 ATGAAGAAGAAGGAAGAGACTGG + Intergenic
1131930449 15:97435010-97435032 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1132389039 15:101425331-101425353 AGGGAGAACCAGGAGGAAGCGGG - Intronic
1132613843 16:830777-830799 ATGACGACCAAGGCAGAGGCTGG - Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133372707 16:5257471-5257493 AGGCAGAACAAGGAAAAGGATGG - Intergenic
1133529557 16:6641922-6641944 ATGGAAAAAAGAGAAGAGGCTGG - Intronic
1133583220 16:7166501-7166523 TTGGAGAAGAAGGAACAGGATGG + Intronic
1134016985 16:10895594-10895616 GTGGGGAACGAGGGAGAGGCGGG - Intronic
1134184506 16:12073992-12074014 ATGGAAAACAAAAAAAAGGCAGG - Intronic
1134403843 16:13938045-13938067 CTGGAGATGAAGGAAGAGACGGG - Intronic
1135066537 16:19314898-19314920 AGGGAGAAGAAGGGAGAGGAAGG + Intronic
1135147990 16:19979736-19979758 AGGGAGAAAAGGGAAGAGGGAGG + Intergenic
1135375593 16:21944224-21944246 ATGGAGAACAAAGAAGAGCAGGG - Intergenic
1135460929 16:22642275-22642297 ATGGTGAACAAGAAAGATGCAGG - Intergenic
1135572697 16:23561406-23561428 ATGGAGAAGAAAGAAGACTCAGG + Intronic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1136174094 16:28505819-28505841 AGAGAGGACAGGGAAGAGGCAGG - Intronic
1136539093 16:30918682-30918704 AAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1137032464 16:35536488-35536510 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1137239874 16:46647115-46647137 ATGGCAGACAAGGAAGGGGCAGG - Intergenic
1137482439 16:48863839-48863861 ATAAAGATCAAGGAGGAGGCCGG - Intergenic
1137493139 16:48949818-48949840 ATGGAGGGCAGGGGAGAGGCTGG - Intergenic
1137627186 16:49916618-49916640 ATGGAGAACCAGGAGGCTGCTGG - Intergenic
1137862814 16:51863825-51863847 AAGCAGAAAAAGGAAGAGACCGG - Intergenic
1137934091 16:52617218-52617240 ATGGAGAAAAAGAAAAAGCCAGG + Intergenic
1138087151 16:54143538-54143560 AAAGAGAAGAAGGAAGAAGCAGG + Intergenic
1138182343 16:54950047-54950069 ATGGAGAACAAGAGAGATTCCGG - Intergenic
1138541602 16:57691055-57691077 AAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1138942162 16:61803635-61803657 ATGGAAAACAAAAAAAAGGCAGG + Intronic
1139421456 16:66851759-66851781 ATGGGGAGAGAGGAAGAGGCTGG + Intronic
1139908114 16:70380562-70380584 ATGGAGAGCAGGGTGGAGGCAGG + Exonic
1139923360 16:70473039-70473061 GTGGAGCACAGGAAAGAGGCGGG - Exonic
1140146347 16:72314043-72314065 AGGGAGCACAAGAAACAGGCTGG + Intergenic
1140190758 16:72813975-72813997 ATGGAGAATAAGGAAGTTTCTGG - Intronic
1140309858 16:73838953-73838975 AGGGAGATCAAGGAAGAACCAGG + Intergenic
1141065856 16:80913068-80913090 TTGGAGAAGCAGGAAGAGCCAGG - Intergenic
1141066005 16:80914584-80914606 AAAGAGACCAAGCAAGAGGCCGG + Intergenic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141992722 16:87619842-87619864 ATGGGGCGCAAGGAAGGGGCTGG + Intronic
1142329201 16:89440130-89440152 CTGGAGAAGTAGGAAGAGGCAGG - Intronic
1142407005 16:89895898-89895920 ATGGACAACAAGGAAAGGTCTGG - Intronic
1142453542 16:90200887-90200909 ATGGAGAACAAAGAGCAAGCTGG - Intergenic
1142637350 17:1266318-1266340 CTTGAGCAGAAGGAAGAGGCAGG + Intergenic
1142935818 17:3330535-3330557 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1143250988 17:5522837-5522859 GTAGAGAACAAGGAGGAGGAAGG + Intronic
1143263101 17:5614815-5614837 ATGAAGAACAAAGAAGAGAATGG - Intronic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143516520 17:7421815-7421837 ATTGAAAACAAGGTAGAGGCAGG - Intergenic
1143565852 17:7720091-7720113 AGAAAGAACAAGGATGAGGCTGG - Intronic
1143741278 17:8955725-8955747 GTGGGGAACAAGGAAGATGGAGG + Intronic
1143814742 17:9503522-9503544 ATGAATAAAAAGGAAGAGGGAGG - Intronic
1143850162 17:9804973-9804995 CTGGAAAACAAGGAAGAGCTTGG + Intronic
1144059272 17:11567941-11567963 ATGGAGAACAAGGAAAGGATGGG + Intergenic
1146473164 17:33140456-33140478 AAGGAGAACAATGAAGACTCAGG - Intronic
1146670540 17:34734403-34734425 AGGGAGATCATGGCAGAGGCTGG + Intergenic
1147046739 17:37758028-37758050 ATTGAGAACAATGAAAGGGCAGG + Intergenic
1147631491 17:41935161-41935183 ATGAAGAGCAAGGTAGAAGCTGG - Intronic
1147641248 17:42001824-42001846 ATGGAGAAGAATGGAGAGGGAGG - Intronic
1148245602 17:46027942-46027964 TTGGAGAACAAAGATGAGGAGGG - Exonic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1148615320 17:48996739-48996761 GTGGAGAACGAGGAAGCCGCAGG - Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1149099564 17:52887541-52887563 ATTGAAAACAAGAAGGAGGCTGG + Intronic
1149310254 17:55386328-55386350 CTGGAGAGGGAGGAAGAGGCGGG - Intergenic
1149370133 17:55985770-55985792 ATGGTGAGCCAGGGAGAGGCTGG - Intergenic
1149372110 17:56004771-56004793 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1150190594 17:63233515-63233537 ATGGAGAGCAAGGAAAAAGCAGG - Intronic
1150800006 17:68273861-68273883 TTGAAGAACAAGGAAGGGGAAGG - Intronic
1150876681 17:68978291-68978313 ATGGAAAACAAAAAAAAGGCAGG - Intronic
1151604613 17:75128651-75128673 TGGGAGAGCAAGGAAGAGTCTGG - Intronic
1152137098 17:78510941-78510963 GTGGAGACCAAGGCAGAGACAGG + Intronic
1152194990 17:78912551-78912573 ATGAAGAGCACAGAAGAGGCGGG + Intronic
1152243815 17:79175036-79175058 AGGAAGAGGAAGGAAGAGGCAGG - Intronic
1153374747 18:4363221-4363243 AGGGAAAACAAGGAAGGGCCCGG + Intronic
1153718450 18:7875708-7875730 ATAGAGAGAAAGGAAGAGGCAGG - Intronic
1153785596 18:8531368-8531390 ATGGAAAACAGGAAAAAGGCAGG + Intergenic
1154396180 18:13991620-13991642 GAGGAGGACAAGGGAGAGGCTGG + Intergenic
1155815815 18:30307962-30307984 CTGGAGAAAAAGGAAGAGGTGGG + Intergenic
1157205727 18:45696767-45696789 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157330396 18:46699924-46699946 ACTGAGACCAAGAAAGAGGCTGG - Intronic
1157700076 18:49756749-49756771 ACGGGGAACAAGGCAGTGGCAGG + Intergenic
1157803996 18:50644531-50644553 TTGGAGAGAAAGGAAGAGGGAGG - Intronic
1158054102 18:53259033-53259055 ATGGAAAACAAAAAAAAGGCAGG - Intronic
1158114266 18:53977600-53977622 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1158445150 18:57513510-57513532 AGGCAGAACAATGAAGAAGCTGG - Intergenic
1158803123 18:60936803-60936825 CTGGAGCAGGAGGAAGAGGCAGG + Intergenic
1158835881 18:61331726-61331748 AAGGAGAAGGAGGAAGAGGGAGG - Intergenic
1159072118 18:63636865-63636887 ATGGAGAGAAAGAAAGAGCCTGG - Intergenic
1159283012 18:66311231-66311253 CTGGGCAACAAGGCAGAGGCTGG - Intergenic
1159311638 18:66717261-66717283 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1159515364 18:69451229-69451251 ATGGAAAACAAAAAAAAGGCAGG + Intronic
1159612013 18:70536114-70536136 ATGAAGAAAATGTAAGAGGCCGG - Intergenic
1160106751 18:75984943-75984965 ACTGAGAACAATGGAGAGGCTGG + Intergenic
1160121317 18:76132857-76132879 ATGGAGGTCAAGGAAGTGGCTGG + Intergenic
1160479550 18:79226266-79226288 GTGGAACACAAGGAAGATGCTGG - Intronic
1160485501 18:79288437-79288459 ATGGAAAACAAAAAAAAGGCAGG - Intronic
1160629834 18:80239132-80239154 AGGGAGAATAAGGGAGAGGTGGG + Intronic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1160925352 19:1542229-1542251 AGGGAGAAGAAGGAAGAAGAAGG - Intergenic
1160950836 19:1666515-1666537 AAGGAGAAGAAGGAAGAAGGAGG - Intergenic
1161729108 19:5948070-5948092 AAGACGAACAAGGAAGAAGCAGG + Intronic
1162080490 19:8214966-8214988 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162080503 19:8215008-8215030 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162391680 19:10393728-10393750 AGGGAGACCAAGGACAAGGCAGG - Intronic
1162444816 19:10716343-10716365 ATGGAGAAAGAGGAGGAGGGTGG - Intergenic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163610099 19:18296159-18296181 TAGGAGAACAAGGAAGAGATAGG - Intergenic
1163973643 19:20826828-20826850 ATGGAAAACAAAAAAAAGGCAGG + Intronic
1164391147 19:27822361-27822383 CTGGAGAATATGGAAGGGGCTGG + Intergenic
1164495735 19:28759160-28759182 ATGGAAAACAAAAAAGAAGCAGG + Intergenic
1164599660 19:29552416-29552438 ATGGAGAGCAAGGAAAAGCAGGG + Intronic
1164803076 19:31093668-31093690 ATGGAGAACTGGGGAGAGGGAGG - Intergenic
1165116405 19:33531559-33531581 AAGGAAAAGAAGGAAGGGGCCGG + Intergenic
1165264384 19:34647692-34647714 ATGAAGAACAAGGCAGATGAGGG + Intronic
1165724200 19:38101115-38101137 ATGTACAACAATGAGGAGGCCGG + Exonic
1165930902 19:39357790-39357812 ATGGAGGCCAAAGAAGAGGGAGG + Intronic
1166540866 19:43604820-43604842 ATGGAGAAAAAGGAACAGGGTGG - Intronic
1166613752 19:44224590-44224612 ATGGAAAACAAAAAAAAGGCAGG - Intronic
1166621803 19:44307746-44307768 GAGGAGAACAAGGAAGAGAAGGG + Intergenic
1167058850 19:47130931-47130953 ATGGTGGAGAAGGAGGAGGCTGG + Exonic
1167467243 19:49656789-49656811 ATGGAGGACATGGCACAGGCTGG - Intronic
1167602859 19:50464761-50464783 TTGAAGGACAAGGAAGAGGAAGG + Intronic
1168418264 19:56183252-56183274 AGGGGGAACAAGGAAGTGGCAGG + Intronic
1168423407 19:56219919-56219941 ATGGGGAGGAAGGAAGAGGAGGG + Exonic
1202653570 1_KI270707v1_random:28004-28026 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
925102538 2:1260450-1260472 AAGGAGATGAAGGAAAAGGCCGG + Intronic
925216111 2:2097097-2097119 AAGGAGGCCAGGGAAGAGGCTGG - Intronic
925449568 2:3957129-3957151 CTGGAGGACAAGGAAGATGTGGG - Intergenic
925526838 2:4812752-4812774 AGGGAGCCAAAGGAAGAGGCAGG + Intergenic
925861430 2:8180864-8180886 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
926119899 2:10236215-10236237 ATGGAGAAGAGGGAAGAGGGTGG - Intergenic
926636607 2:15186803-15186825 ATGGAGAACAAGGAAGGATTGGG - Exonic
927066232 2:19473721-19473743 ATGGAGAACAGAGAAGGGGCTGG - Intergenic
927206438 2:20614110-20614132 ATGAAGACAAAGGCAGAGGCTGG + Intronic
927416263 2:22883817-22883839 ATGGAAAAAAGGGAAGAGGAGGG + Intergenic
927502491 2:23591893-23591915 CTGGAGATAAAGGAAGAGGAAGG - Intronic
927993272 2:27463309-27463331 ATAGAGACCAAGGAAGATGAGGG + Intronic
928090073 2:28368512-28368534 ATGGTGTAGAACGAAGAGGCTGG - Intergenic
928154597 2:28865598-28865620 CTGGAGAAAAATCAAGAGGCAGG + Intronic
928390531 2:30906376-30906398 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
928409367 2:31042656-31042678 GTGGAGAGTAAGGAAGAGGAAGG - Intronic
929046844 2:37798645-37798667 ATGGGGAAAAAGGCAGAGGGTGG - Intergenic
929955321 2:46453834-46453856 ATGGAGAGCCAGGTAGAGTCAGG - Intronic
930556661 2:52904406-52904428 ATGAAGAACAGGGAAGTGACAGG - Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930852543 2:55975885-55975907 CTGGAGCACAAGGAATAGTCAGG + Intergenic
930945703 2:57072322-57072344 ATTGAGGAGAAGGAAGAGGAGGG - Intergenic
931308733 2:61057991-61058013 TTGGTGAACAAGGAAGATCCTGG - Intergenic
931537124 2:63291510-63291532 ATGAAAAACAAAGAGGAGGCTGG + Intronic
931822526 2:65966892-65966914 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
932727215 2:74189765-74189787 ATGGAAAAGAAGGAAAAGGACGG + Intergenic
933005646 2:76990469-76990491 ATGGAAAACAAGAAAGAGCAGGG + Intronic
933050436 2:77594997-77595019 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
933436634 2:82257650-82257672 ATGGAGAATAAGGAAAAGCAGGG - Intergenic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
933509763 2:83225686-83225708 ATGGAGAATAAGGAAAAGGGTGG + Intergenic
933664738 2:84955872-84955894 ATGGATAAGAAGTAACAGGCTGG + Intergenic
933778898 2:85787970-85787992 TTTGAGCACAAGGAAGGGGCGGG - Exonic
933855709 2:86412257-86412279 AGGGAGAAGAAGGAAGAAGGAGG - Intergenic
934128564 2:88922830-88922852 ATGAAGAAAAAGGAGGAGGACGG + Intergenic
934571381 2:95375113-95375135 GGGGAGGGCAAGGAAGAGGCTGG - Intronic
934802275 2:97176448-97176470 ATGGAAAACAAAAAAAAGGCAGG - Intronic
935369204 2:102326671-102326693 ATGGAAAACAAAAAAAAGGCAGG + Intronic
935609629 2:105007808-105007830 GTGGAAAACAAGGATGAGGAAGG + Intergenic
935844983 2:107155830-107155852 CTGGAGCTCAAGGCAGAGGCTGG - Intergenic
936045153 2:109181711-109181733 CTGGAGAAGAAAGAGGAGGCAGG - Intronic
936075396 2:109398442-109398464 AGGGAAAACACAGAAGAGGCTGG - Intronic
936290528 2:111220377-111220399 AAGGAGACCAAGGAACAGGATGG - Intergenic
936823356 2:116551674-116551696 ATTGTGCACTAGGAAGAGGCTGG - Intergenic
937012022 2:118571574-118571596 ATGGTGAAAAGGGAAGAGCCTGG - Intergenic
937051935 2:118899589-118899611 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
937285892 2:120750934-120750956 CTGCAGAGCAAGGTAGAGGCAGG - Intronic
937339593 2:121082635-121082657 ATGGAGAGACAGGGAGAGGCAGG + Intergenic
937606470 2:123807355-123807377 ATGGAGAACAAAGAAAAGCAAGG + Intergenic
937850853 2:126634432-126634454 GTGGAGCACAGGGAAGTGGCAGG - Intergenic
938168690 2:129056348-129056370 ATGGTGAATTAGAAAGAGGCTGG + Intergenic
938170989 2:129076560-129076582 GTGGAAAACAAGGAAGACTCAGG + Intergenic
939619972 2:144406900-144406922 ATGGAGATGAAGGAAGTGTCTGG + Intronic
939779779 2:146431626-146431648 ATTGGGAAGAAGGGAGAGGCAGG + Intergenic
940057251 2:149525984-149526006 ATGGAGAACAAAGAAAAGCAGGG - Intergenic
940253210 2:151702690-151702712 ATGGAAAACAAAAAAAAGGCAGG - Intronic
940575962 2:155504366-155504388 ATGGAAAACAAAGAAGAGCAAGG + Intergenic
940823561 2:158385015-158385037 ATGGTGAGCAAGGAAGTGGGGGG - Intronic
941338331 2:164272703-164272725 ATGGAAAAAAAAGAAGAGGAGGG - Intergenic
941396474 2:164980257-164980279 GTGGGGAAGAAGGAAGAGGAAGG - Intergenic
942112685 2:172698268-172698290 GTGGAGAGAAAGGAAGGGGCAGG - Intergenic
942582195 2:177430645-177430667 ATGGAGAACAAAGAAAAGGAGGG - Intronic
942792931 2:179781196-179781218 CTGAAGAACAATGAAGATGCAGG + Intronic
943043299 2:182828494-182828516 ATGGAGAACAGAGAACAGGCAGG + Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943506406 2:188765443-188765465 ATGGAAAAGAAGGAAGACACAGG - Intronic
944035438 2:195289999-195290021 ATGGAGAGCAAGGAAAAGCAGGG + Intergenic
944197002 2:197064620-197064642 ATGGAAAACAAAAAAAAGGCAGG + Intronic
944212901 2:197225051-197225073 AGGGAGAAAAGGGAAGAGGAGGG + Intronic
944656154 2:201878427-201878449 ATGGAGGGCAGGAAAGAGGCAGG - Intronic
944900999 2:204216039-204216061 TTGGAGGAGAAGGAAGAGGAAGG - Intergenic
945024415 2:205606401-205606423 ATGGAGAGCAAGGAAAAGCAGGG - Intronic
945950860 2:216037423-216037445 GTGGAGAAGATGGAAAAGGCAGG - Intronic
946005443 2:216520753-216520775 ATGGAAGACGAGGAAAAGGCAGG + Intronic
946115496 2:217458427-217458449 AAGGAGAATAAGAAAGAGGCTGG - Intronic
946173527 2:217909148-217909170 CTGGAAAAGAAGGGAGAGGCTGG - Intronic
946205670 2:218106378-218106400 ATGGAAAACAAGAAAAAAGCAGG - Intergenic
946327188 2:218990783-218990805 ATGGGGACCAAGGAAGAGGGTGG - Intronic
947318786 2:228894567-228894589 AAGAAGAATAAGGGAGAGGCCGG - Intronic
947758666 2:232587758-232587780 GTTTAGTACAAGGAAGAGGCTGG - Intergenic
948260540 2:236601220-236601242 TGGGAGAACCAGGCAGAGGCTGG - Intergenic
948417261 2:237819401-237819423 GTGGAGAACCAGGAAGTGGGAGG + Intronic
948516710 2:238508635-238508657 ATTGAGAACTAGGAAGATGCTGG - Intergenic
948887007 2:240889500-240889522 GAGAAGAACAAGGAACAGGCAGG - Intronic
949084987 2:242145537-242145559 ATGGAGAACAAAGAGCAAGCTGG - Intergenic
1168763346 20:364943-364965 CTGAAGAAGAAGGAAGAGCCTGG + Intronic
1168957742 20:1846418-1846440 ATGGAGAACAAGGTGGAGAGTGG + Intergenic
1169044995 20:2528097-2528119 ATGGAGCAGAAGAAAGGGGCAGG + Intergenic
1169221004 20:3823006-3823028 AAGAAGAACAAGGGAAAGGCAGG - Intronic
1169730699 20:8782636-8782658 TTTGAAAACAAGGTAGAGGCAGG - Intronic
1170337761 20:15289558-15289580 GTGAAGAACAAGGAAGTGGCAGG + Intronic
1170348507 20:15414637-15414659 AAGGATAACCAGGAAGAGGCTGG - Intronic
1170701878 20:18711360-18711382 AGGGAAACCAAGGCAGAGGCTGG - Intronic
1170935372 20:20805029-20805051 GTAGAGAAGAAGGGAGAGGCTGG + Intergenic
1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG + Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171738437 20:28828032-28828054 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1171763503 20:29234643-29234665 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1171959787 20:31485483-31485505 AGGGAGACCCAGGAGGAGGCTGG - Intergenic
1172251614 20:33483549-33483571 CAGGAGGACAAGGCAGAGGCAGG + Intergenic
1172884628 20:38222823-38222845 AGGGAGATCAGCGAAGAGGCTGG - Intronic
1173346891 20:42208461-42208483 ATGGAAAACAAAAAAAAGGCAGG + Intronic
1173997152 20:47347026-47347048 ATGGGGAGGGAGGAAGAGGCTGG - Intronic
1174045028 20:47727318-47727340 ATGAAGATGAAGGCAGAGGCTGG + Intronic
1174465243 20:50712246-50712268 ATGGAGTTCAGGGGAGAGGCTGG + Intergenic
1174544714 20:51316777-51316799 ATGCAGAACAAGGAAGAAGGAGG - Intergenic
1174567711 20:51478766-51478788 GTGGAGGAGAAGGCAGAGGCTGG - Intronic
1174870974 20:54181796-54181818 ATGGAGGACAGGGAAGAGAAGGG + Intergenic
1175155294 20:56967287-56967309 ACGGAGAAGAAAGAGGAGGCTGG - Intergenic
1175175387 20:57108808-57108830 ATGAAGAAGGAGGCAGAGGCAGG - Intergenic
1175499080 20:59436771-59436793 AGGGAGAGAAAGGGAGAGGCAGG + Intergenic
1175553373 20:59831279-59831301 CTGGGGAGCCAGGAAGAGGCTGG - Intronic
1175975451 20:62708466-62708488 GCGGAGAACAGGGAAGAGGGTGG + Intergenic
1176590238 21:8641383-8641405 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1176598563 21:8771260-8771282 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1176724291 21:10417253-10417275 AAGGAGATCAAGGAAGAAGCAGG + Intergenic
1177505699 21:22015155-22015177 ATGAAGAACTTGAAAGAGGCAGG - Intergenic
1177815595 21:25973183-25973205 AAGAAGAACAAGGAACAGACTGG + Intronic
1178028446 21:28495601-28495623 TTGAAGAACAAGGAAAAGACTGG - Intergenic
1178858701 21:36271571-36271593 ATGGATACAAAGGAAGAGTCTGG - Intronic
1178887676 21:36496656-36496678 ATGGAGAAGAAAGCAGAGGAAGG + Intronic
1179343963 21:40538780-40538802 ATGGAGCACAAGGGAGGGGAAGG + Intronic
1179453307 21:41480246-41480268 ATAGAGGCCAAGGAGGAGGCAGG + Intronic
1180147769 21:45930763-45930785 CTGGAGAGCAAAGAAGAGACAGG - Intronic
1180257027 21:46636477-46636499 ATTGAGAAGAAGGAAAAGACTGG + Exonic
1180377629 22:12109633-12109655 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1181943473 22:26497050-26497072 CAAGAGAACAAGGAAGAGGCAGG - Intronic
1182148247 22:28010737-28010759 ATGAAGCAGAAGGAAGGGGCTGG - Intronic
1182247335 22:28969587-28969609 AGGGTGAACAAGAAAGAGACTGG + Intronic
1182383890 22:29919040-29919062 AGGGAGAATAAGAAATAGGCTGG - Intronic
1182649594 22:31840393-31840415 ATGGAGCACAAGGAATAAGCCGG + Intronic
1183163364 22:36129522-36129544 GTAGAGCACAAGGAAGAGGCTGG + Intergenic
1183987664 22:41578308-41578330 ATGGAGAGGGAGGAAGAGCCTGG + Intronic
1184003823 22:41694505-41694527 AAGAAGGACAAGAAAGAGGCTGG + Exonic
1184015500 22:41782942-41782964 ATGCAGAGGAGGGAAGAGGCGGG - Intronic
1184124398 22:42476822-42476844 CTGGAGAACAAAGGAGAGACTGG - Intergenic
1184671970 22:46017850-46017872 ATGGAGAAAAAAGAAGAGAATGG - Intergenic
1184909019 22:47513618-47513640 ATGGAGATGAAGGCAGAGGCTGG - Intergenic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1185263637 22:49885745-49885767 CTGGAGAAGTAGGAAGGGGCGGG - Exonic
1185288189 22:50011579-50011601 ATGGAAAACAGGGAGGGGGCAGG - Intronic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
949308498 3:2670416-2670438 ATGGAAAACAAAAAAAAGGCAGG - Intronic
949342752 3:3046944-3046966 ATGGAAAACAAAAAAAAGGCAGG + Intronic
949755006 3:7399239-7399261 TTAGAGAACAAGGTAGAGGGTGG - Intronic
950114979 3:10444873-10444895 AGGAAGAAGAAAGAAGAGGCAGG - Intronic
950404612 3:12796890-12796912 AGGGAGAAGAGAGAAGAGGCAGG - Intronic
950456215 3:13094237-13094259 AGGGAGATCATGGAAGAGGCAGG + Intergenic
950552537 3:13675397-13675419 AGGGAGGCCAAGGAGGAGGCCGG - Intergenic
950747797 3:15104565-15104587 AATGAGAAAAAGGATGAGGCTGG + Intergenic
950751135 3:15129043-15129065 AGGCAGAACAAGGAAAAGGATGG - Intergenic
950970555 3:17182906-17182928 ATGGAGAACAAGGCAAAGGGAGG - Intronic
952045425 3:29313257-29313279 ATGCACAACAAGAAAGAGGTAGG + Intronic
952248445 3:31624243-31624265 CAGGAGCACAAGGCAGAGGCTGG - Intronic
952543212 3:34389790-34389812 ATGGAGATAATGGAAGAGGACGG + Intergenic
952698710 3:36302658-36302680 ATGGGGAAGAAGGCAAAGGCTGG + Intergenic
952913286 3:38209558-38209580 ATTGAAACCAAAGAAGAGGCCGG - Intronic
953428393 3:42815644-42815666 AAGCAGATCAAGGAAGAGTCTGG - Intronic
953643781 3:44734242-44734264 AGGCTGAACAAGGAAGAGGAAGG + Exonic
953660551 3:44888503-44888525 AGGGAGAGGAAGGAAGAGGCCGG - Intronic
953866295 3:46586012-46586034 AAGGAGGAGAAGGAAGAGGAGGG + Intronic
954036060 3:47851879-47851901 CTGGAGAACAAGAAAGGGCCAGG - Exonic
954423759 3:50432518-50432540 TCGGAGAACAAGGGAAAGGCAGG + Intronic
954498429 3:50987688-50987710 ATGGAGAACGAAGAAAAGGCAGG + Intronic
954593079 3:51800899-51800921 TTGAAGAACACGGAGGAGGCCGG + Intergenic
954653347 3:52178612-52178634 AAGGACAATAAGGAGGAGGCTGG + Intergenic
954916442 3:54151888-54151910 ATGGGCAACAATGAGGAGGCAGG - Intronic
955022946 3:55138504-55138526 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
955645908 3:61137193-61137215 ATGGGGAAGAAGGAAGGAGCAGG - Intronic
955670400 3:61395572-61395594 ATGGAAAACAAAGAAAAGGCAGG + Intergenic
955843696 3:63138451-63138473 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
955933723 3:64082574-64082596 AGGGAAAAGAAGGAAGAGGGAGG - Intergenic
956366350 3:68507297-68507319 ATGGAGAACCATGATGAGACAGG + Intronic
956461652 3:69479029-69479051 ATGGAAAACAAAAAAAAGGCAGG - Intronic
956747859 3:72323700-72323722 AAGAGGAACAAGGAAGAAGCTGG - Intergenic
956954138 3:74317160-74317182 ATGGAAAACAAAAAAAAGGCAGG - Intronic
957111076 3:75958627-75958649 ATAGAGAGCAAGGAAGTGGTGGG + Intronic
957320651 3:78625899-78625921 AGGGAGGCCAAGGAAGAGGAAGG + Intronic
957562729 3:81844267-81844289 ATTGAGTCCAAGAAAGAGGCTGG + Intergenic
957879008 3:86185778-86185800 ATGGAAAACAAAAAAGAGGAGGG + Intergenic
958081318 3:88749216-88749238 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
958167986 3:89901705-89901727 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
958835331 3:99138867-99138889 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
959464416 3:106667477-106667499 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
960017728 3:112911965-112911987 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
960363671 3:116745157-116745179 ATGGAAAACAAAAAAAAGGCAGG + Intronic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960783773 3:121349781-121349803 ATGGAAAACAAAAAAAAGGCAGG - Intronic
960790754 3:121428268-121428290 TGAGAGAACAAGGAAGAGACTGG + Intergenic
961303628 3:125938820-125938842 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
961660553 3:128466609-128466631 AAGGAGACCATGGAAGAGGTTGG - Exonic
961726340 3:128933389-128933411 ATAGAGGAGAAGGAGGAGGCTGG + Intronic
961895466 3:130164266-130164288 ATGGAAAACAAAAAAAAGGCTGG - Intergenic
961914334 3:130356038-130356060 ATGCAAAAAAAGGAAGAGGAGGG - Intronic
961937732 3:130603487-130603509 ATGGACAAGAAGGAAGAATCTGG + Intronic
962009046 3:131376036-131376058 CTGGAGAACAAGGATGAGGCAGG + Intergenic
962143575 3:132816890-132816912 TTGGGGAACCAGGAACAGGCTGG + Intergenic
962176534 3:133161125-133161147 ATGGTGCCCAAGGTAGAGGCGGG - Intronic
962545465 3:136429715-136429737 ATGGAGAAGGAAGGAGAGGCAGG - Intronic
962952187 3:140229489-140229511 ATGGAGAAAAAGGAAAAGGAGGG - Intronic
963449755 3:145463376-145463398 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
964332585 3:155620470-155620492 ATGGAGAACAAGGTAGTGTCAGG + Intronic
964389762 3:156184929-156184951 ATGGAGACCAACTAAGTGGCAGG + Intronic
964500436 3:157342344-157342366 ATGGAAAACAAAAAAAAGGCAGG + Intronic
964536435 3:157726877-157726899 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
965253291 3:166369514-166369536 ATGGAGAGCAAGGAAAAGCAGGG - Intergenic
965717939 3:171627177-171627199 ATGGAAAACAAAAAAAAGGCAGG + Intronic
966025964 3:175282474-175282496 AAGGAGAAAGAGGAAGAGGGAGG + Intronic
966248404 3:177834477-177834499 AAGGAGAACAAAGAGGAGGGTGG + Intergenic
966907078 3:184534325-184534347 TTGAAGAGCAAGGGAGAGGCTGG + Intronic
967303653 3:188040503-188040525 ATGGGCAAGAGGGAAGAGGCAGG + Intergenic
967487832 3:190054863-190054885 ATGGAGAACAAGATGGAGGGGGG - Intronic
967646044 3:191925102-191925124 ATAGAAAAAAATGAAGAGGCCGG - Intergenic
967662535 3:192130566-192130588 ATGGAGAAAAAGGAAAACTCAGG + Intergenic
968052189 3:195662811-195662833 CTGGAGCACAGGGAGGAGGCAGG - Intergenic
968272250 3:197412227-197412249 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
968454557 4:690383-690405 ATGGGGAACAAAGATGAGGGGGG - Intergenic
969013925 4:4090420-4090442 AGGCAGAACAAGGAAAAGGATGG + Intergenic
969235930 4:5865065-5865087 ATGGAGGAGGAGGAGGAGGCTGG - Intronic
969646060 4:8429770-8429792 GTAAAGAACAAGGAAGAGCCAGG + Intronic
969740056 4:9018019-9018041 AGGCAGAACAAGGAAAAGGATGG - Intergenic
969747305 4:9082841-9082863 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
969799219 4:9549528-9549550 AGGCAGAACAAGGAAAAGGATGG - Intergenic
970027318 4:11637163-11637185 ATGGTGAAAAATGAAGAGGAAGG + Intergenic
970096025 4:12463608-12463630 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
970203837 4:13635973-13635995 ATTGACAACAGGGAATAGGCTGG + Intergenic
970220036 4:13800714-13800736 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
970222890 4:13828430-13828452 TTAGACATCAAGGAAGAGGCAGG - Intergenic
970450177 4:16158447-16158469 ATGGATAAGAAGGGAGAGGAAGG - Intergenic
970489689 4:16559383-16559405 ATGGAAAACAAAAAAAAGGCAGG + Intronic
970893568 4:21075462-21075484 ATGGAAAACAAAAAAAAGGCAGG - Intronic
970896227 4:21107422-21107444 ATGGAAAACAAAAAAAAGGCAGG - Intronic
970928523 4:21482134-21482156 ATGGAAAACAAAAAAAAGGCAGG - Intronic
971781248 4:31037198-31037220 ATAGAGAACAAGGCAGAGATGGG - Intronic
972199038 4:36691024-36691046 ATGGAGAACAAAAAAGAGCAAGG - Intergenic
972317612 4:37942347-37942369 ATGGAAAACAAAAAAAAGGCAGG - Intronic
972455376 4:39248671-39248693 ATGGAAAACAAAAAAAAGGCAGG + Intronic
973314978 4:48750162-48750184 AAGAAAAAAAAGGAAGAGGCTGG + Intronic
973597082 4:52503183-52503205 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
973625852 4:52771982-52772004 ATAGAAAACAAGGAAAAAGCAGG - Intergenic
974274369 4:59698187-59698209 AAGGAGAATGAGGAAGAGGAGGG + Intergenic
974421814 4:61685461-61685483 ATAAAGAACAATGAAGGGGCTGG + Intronic
974499358 4:62679065-62679087 ATGGAGAATAAGGAAAATTCAGG - Intergenic
974563014 4:63546315-63546337 ATGGTCAACAAGGTAAAGGCAGG + Intergenic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
975043827 4:69777538-69777560 ATGGAGAAAGAGGAAGACGATGG + Intronic
975050104 4:69852474-69852496 ATGGGGAAGAAGGAAGAAGCGGG - Intronic
975077297 4:70226992-70227014 ATTTAGAAGAAGAAAGAGGCAGG - Intronic
975150378 4:71014086-71014108 ATGGAAAACAAAAAAAAGGCAGG + Intronic
975260059 4:72287512-72287534 AGAGAGAGCCAGGAAGAGGCAGG + Intronic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975368214 4:73552939-73552961 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
975955388 4:79831051-79831073 ATGGAAAATTAGGAAGAGGGAGG + Intergenic
976682390 4:87771388-87771410 ATGGAAAACAATAAAAAGGCAGG + Intergenic
976761785 4:88557080-88557102 AGGGAGAGGAAGGAAGAGGTGGG - Intronic
976996478 4:91439782-91439804 ATGGAAAACAAAAAAAAGGCAGG + Intronic
977153397 4:93542735-93542757 ATGAATAAGAAGGCAGAGGCTGG - Intronic
978022395 4:103830269-103830291 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
978136901 4:105273325-105273347 ATGGAAAACATGGAAAAGTCTGG + Intronic
978295921 4:107205130-107205152 ATGAAGAACAGGGAAGGTGCTGG + Intronic
978835350 4:113142722-113142744 ATGAAGAAAAAGAAAGAGGGGGG + Intronic
979262420 4:118663782-118663804 ATGGAGAACAAAGAGCAAGCTGG - Intergenic
979561216 4:122104194-122104216 CTGGAGAACAAGGACTGGGCAGG + Intergenic
979706277 4:123723695-123723717 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
979935912 4:126695291-126695313 ATGGTGGGCAAGGAAGAGGCAGG - Intergenic
979973699 4:127169434-127169456 ATGGAGAAGAAGGTATTGGCTGG - Intergenic
979993162 4:127399827-127399849 AAAGAGAAAAAGGAAGAGGTTGG + Intergenic
980010711 4:127591115-127591137 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
980018392 4:127678920-127678942 ATGGAAAACAAAAAAAAGGCAGG + Intronic
980033918 4:127861837-127861859 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
980333759 4:131441648-131441670 ATGGAGAACAAAGAAAAGTAGGG - Intergenic
980411724 4:132428785-132428807 ATGGAAAACAAGAAAGAGCAGGG - Intergenic
980489319 4:133505391-133505413 ATGGAGAGGAAGGAAGAGCAGGG + Intergenic
980579171 4:134727461-134727483 ATGGAGTCAAAGGAAGAGGAAGG + Intergenic
981222201 4:142250156-142250178 AGAGAGAATAAGGAAGAGGTGGG - Intronic
981299312 4:143168763-143168785 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
981366386 4:143908581-143908603 GTGGAGAACAGGGGAGGGGCAGG + Intergenic
981376496 4:144022356-144022378 GTGGAGAACAGGGGAGGGGCAGG + Intergenic
981387006 4:144143702-144143724 GTGGAGAACAGGGGAGGGGCAGG + Intergenic
981418888 4:144526179-144526201 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
982023534 4:151229614-151229636 ACAGAAAACAAGGCAGAGGCTGG + Intronic
982043682 4:151420426-151420448 ATGGGGAAAAAGGAAGAGGTAGG - Intronic
982168245 4:152636048-152636070 CTCCAGAAGAAGGAAGAGGCTGG + Intronic
982405842 4:155019597-155019619 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
983117798 4:163841107-163841129 ATGGGGACCAGGGAGGAGGCAGG + Intronic
983182241 4:164662094-164662116 ATGTAGAACAAGAAAGACACTGG + Intergenic
983501433 4:168504104-168504126 AAGGAGGACAAAGATGAGGCAGG - Intronic
983699812 4:170578599-170578621 AGGGAGAACATGGAAGAGCAGGG + Intergenic
983983260 4:174025324-174025346 ATGGTGAAAAAGGAAGAGAAAGG + Intergenic
984004307 4:174290148-174290170 ATTAAGAAGAAGAAAGAGGCAGG - Intronic
984015006 4:174415719-174415741 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
984540307 4:181030135-181030157 ATGAGGAAAAAGGAAGATGCTGG - Intergenic
984574375 4:181429897-181429919 AGTTAGAATAAGGAAGAGGCAGG - Intergenic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985070513 4:186162976-186162998 TTGCAGCACAGGGAAGAGGCTGG - Intronic
985112724 4:186562668-186562690 ATAAAGCAAAAGGAAGAGGCCGG - Intergenic
985168357 4:187121942-187121964 GTGGAGAACAAGGAGCATGCTGG + Intergenic
986724815 5:10586367-10586389 ATGAAGAAGAAAGAAAAGGCTGG + Intronic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987305746 5:16636442-16636464 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
987342925 5:16954361-16954383 ATTGAAAATAAGGAAGGGGCTGG + Intergenic
987442827 5:17978072-17978094 ATGAAGAAAATGGGAGAGGCAGG + Intergenic
988003739 5:25382353-25382375 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988139027 5:27211493-27211515 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
988269300 5:28993336-28993358 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
988483433 5:31648504-31648526 CGGGAGAACAAGGTGGAGGCTGG - Intronic
989560398 5:42843703-42843725 ATGGAGAACAAGGAGTAAGTGGG - Intronic
990142331 5:52720062-52720084 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
990231051 5:53712984-53713006 ATGGAGAGCAAGGAAAAGCAGGG - Intergenic
990573599 5:57103769-57103791 TTGGAGACCAAGTAACAGGCAGG + Intergenic
990600627 5:57355322-57355344 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
990678843 5:58218203-58218225 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
990874226 5:60466797-60466819 ACTGAGAACAACGAAGGGGCAGG - Intronic
990877333 5:60500331-60500353 AAGGAGAAGAAGGAAGAACCTGG + Intronic
990945128 5:61241173-61241195 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
991209679 5:64089487-64089509 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
991213340 5:64132920-64132942 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
991293911 5:65061072-65061094 AGATAGAACAAGGAAAAGGCAGG + Intergenic
991383718 5:66061366-66061388 ATGGAAAACAAAAAAAAGGCAGG - Intronic
991466110 5:66914324-66914346 ATAGAGAAGAAGGACCAGGCTGG + Intronic
992483812 5:77176700-77176722 ATGGAGAGCAAGGGAGAAGAAGG + Intergenic
992678445 5:79129054-79129076 ATAGAGAACTAGGAAGCGGGTGG + Intronic
992682859 5:79170100-79170122 ATGGAGAAGATGGAAGACACTGG - Intronic
992950061 5:81850023-81850045 ATGGAGAACAATAAAGCGGAAGG + Intergenic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993086292 5:83367701-83367723 GTGGAGAAGATGGGAGAGGCTGG + Intergenic
994405753 5:99343438-99343460 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
994477222 5:100286779-100286801 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
994542118 5:101112277-101112299 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
994969466 5:106717691-106717713 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
995138242 5:108703514-108703536 ATCGAGAGAAAGGAAGAGGGAGG - Intergenic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
995369841 5:111406890-111406912 AAGGATATCAAAGAAGAGGCAGG - Intronic
995907168 5:117139242-117139264 TTGGTGAACATGGAAGAGGAAGG + Intergenic
996282818 5:121751904-121751926 ATGGAGAAAAAGGAAAGCGCTGG + Intergenic
996418891 5:123240432-123240454 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
996563650 5:124857319-124857341 TTGAAGAACAACAAAGAGGCCGG + Intergenic
997020346 5:129993533-129993555 ATGGAAAACAAAAAAAAGGCAGG - Intronic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997559672 5:134835351-134835373 ATTGAAAAGCAGGAAGAGGCCGG + Intronic
998172906 5:139882899-139882921 CTGAGGAACAAGAAAGAGGCAGG + Intronic
998308407 5:141102144-141102166 ATGGAGACCAGGGAAGAGAGGGG - Exonic
998312757 5:141151746-141151768 ATGGAGACCAGGGAAGAGAGGGG - Exonic
998404034 5:141863536-141863558 GTGGAGGACGAGGATGAGGCCGG - Exonic
998486856 5:142510438-142510460 GTGAAGAACTAGGCAGAGGCTGG - Intergenic
998788717 5:145743540-145743562 ATGGAGAGCAAGGAAGAGCAGGG + Intronic
998810811 5:145964126-145964148 AAGGAAAGAAAGGAAGAGGCCGG - Intronic
999322496 5:150624298-150624320 AAGGAGAGCCAGGAAGAGGTAGG + Intronic
999429153 5:151511093-151511115 CTGGAGAACAGGGAGGAGGCTGG + Intronic
999477715 5:151916522-151916544 ATGGAGAAAAAGGAAGATCATGG + Intronic
999666487 5:153917777-153917799 ATGGAGAACAAAGAAAAGCAGGG - Intergenic
999857336 5:155608953-155608975 AGTGAGACCAGGGAAGAGGCAGG + Intergenic
1000134599 5:158335185-158335207 ATGGAAAACAAAGAAGAGCAGGG - Intergenic
1000330188 5:160199674-160199696 ATGGAGACGAAGGAGGGGGCAGG - Intronic
1000497637 5:162004933-162004955 ATGGATAACAAGGAAGTTACAGG - Intergenic
1000556588 5:162733711-162733733 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1000767910 5:165315178-165315200 AGAGAGAAGAAGGAAGAGACAGG + Intergenic
1000876459 5:166644836-166644858 CTCAAGAACAAGGAAGAGGAAGG - Intergenic
1001343045 5:170864612-170864634 ATTGAGAAGAAGTAAGAGGTAGG + Intronic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001763101 5:174223672-174223694 ATGGAGAACTCTGGAGAGGCAGG + Intronic
1002010884 5:176280298-176280320 ATGGAAAACAAAAAAAAGGCAGG - Intronic
1002439935 5:179259025-179259047 AGGGTGAGCACGGAAGAGGCAGG - Intronic
1002719125 5:181247148-181247170 CTGGATGAGAAGGAAGAGGCCGG - Intronic
1003055248 6:2812429-2812451 ATGGAAAAGAAGGAATGGGCTGG + Intergenic
1003225540 6:4202338-4202360 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1003384667 6:5656133-5656155 ATGGAAGACAAGGAAGAGGACGG + Intronic
1004266676 6:14154112-14154134 ATGGACAATAAGCAGGAGGCAGG - Intergenic
1004559527 6:16734363-16734385 ATGGAGAACAAAGAAGAACTGGG - Intronic
1005239385 6:23806233-23806255 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1005312168 6:24569273-24569295 AGGGAGAGCATGGAAGAGGAGGG + Intronic
1005513297 6:26531200-26531222 ATGGAGAACTAGGAAGACATAGG + Intergenic
1006049277 6:31328725-31328747 ATGGAGAACAAAGGAAAGGAGGG + Intronic
1006267351 6:32936332-32936354 ATGGAGAACAGAGAAGAGAGTGG - Intronic
1006509781 6:34515626-34515648 AGGGAGAACGAGGAAGGGGAAGG - Intronic
1006637981 6:35474150-35474172 ATTGAGAGCAAGGTAGAGGAAGG - Exonic
1006933800 6:37703627-37703649 ATGGAGAACTAGGAAGGCACTGG + Intergenic
1007175870 6:39896997-39897019 ATAGAGGCCAAGGAAGTGGCCGG - Intronic
1007415222 6:41687703-41687725 GGTGAGAACAAGGAAGAGGGAGG + Intronic
1007537372 6:42605114-42605136 ATGGAGCACAAGGAAGAAGGGGG - Intronic
1007636522 6:43303013-43303035 GTGGAGAACGAGTGAGAGGCTGG - Intronic
1008156545 6:48022142-48022164 AGATAGAACAAGGAAGAGGGAGG - Intronic
1008619507 6:53258149-53258171 GTGGTGAGCAAGGAAGAGGATGG + Intergenic
1008908027 6:56701139-56701161 TTTGAAAAAAAGGAAGAGGCTGG - Intronic
1009045237 6:58230421-58230443 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1009374335 6:62948718-62948740 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1009559681 6:65222924-65222946 ATGAAGAAGAAGTAAGAGTCAGG + Intronic
1009664516 6:66657496-66657518 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1010271419 6:73919822-73919844 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1010351166 6:74876289-74876311 AAGAAGAACAAGGAGGAGGAAGG + Intergenic
1010441785 6:75903550-75903572 ATGGAAAACAAAAAAAAGGCAGG - Intronic
1010633373 6:78227467-78227489 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1010715277 6:79221799-79221821 ATGGAAGACAAGAAAGAGGAGGG + Intronic
1010876701 6:81115875-81115897 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1010992916 6:82500266-82500288 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1011298714 6:85851709-85851731 ATGGAAAACAAAGAAAAGGGAGG - Intergenic
1011525134 6:88255928-88255950 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1011675745 6:89731808-89731830 AAGGAGAAAAAGGAAAAGGTGGG - Intronic
1011760930 6:90564387-90564409 ATGGAAAACAAAAAAAAGGCAGG + Intronic
1012388149 6:98705238-98705260 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1012449493 6:99339847-99339869 ATAGGGAACAAGGAAGAAGAGGG + Intronic
1013793590 6:113860094-113860116 AAGAAGAACAAGAAGGAGGCTGG + Exonic
1014422217 6:121260499-121260521 ATGGAGAGGAAGGAAGAGCAGGG + Intronic
1014529353 6:122541005-122541027 ATGGAAAACAAAAAAAAGGCAGG - Intronic
1014625889 6:123724159-123724181 ATGGAGAAAATGAAATAGGCAGG - Intergenic
1014690529 6:124558388-124558410 ATGGAGTAGAAAGAAGAGTCCGG - Intronic
1015999796 6:139030418-139030440 ATGAAGAACAATGAAGGGGGCGG - Intronic
1016031004 6:139338108-139338130 ATGGAGAAGAACAAAAAGGCAGG + Intergenic
1016380295 6:143470682-143470704 AAGGAAAACAAGGAAAAGTCTGG - Intronic
1016670283 6:146697094-146697116 ATGAAGAACAATGAAGAGAAAGG + Intronic
1017761802 6:157574965-157574987 ATGGGGGGCAGGGAAGAGGCGGG + Intronic
1018606819 6:165606397-165606419 AGTGAGAACAAGGTAGAGGAAGG - Intronic
1018700931 6:166425619-166425641 ATGGAAAACAAAAAAAAGGCAGG + Intronic
1019263229 7:94219-94241 ATGGAGAACTAGGAAGCCCCAGG + Intergenic
1019807284 7:3137206-3137228 ATGGAGAACAAATCAGAGGGAGG - Intergenic
1020872627 7:13650926-13650948 GTGGAGGACAATGAAGAGGAAGG - Intergenic
1021319802 7:19195757-19195779 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1021389128 7:20070103-20070125 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1021400231 7:20201498-20201520 ATGCAGAGAAAGGCAGAGGCTGG + Intronic
1021766010 7:23949478-23949500 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1021862228 7:24917207-24917229 ATGGAGAACAAGGAAGAGGCAGG - Intronic
1021894219 7:25219118-25219140 AGGGAGAAGAAGGAAGAGAGGGG - Intergenic
1022376128 7:29813121-29813143 ATGGGGAAGAAGAAAGAGCCTGG - Intronic
1022883185 7:34612204-34612226 ATGGGGATCTGGGAAGAGGCTGG + Intergenic
1022986827 7:35663722-35663744 ATGGAAAACAAAAAAAAGGCAGG - Intronic
1023047377 7:36222381-36222403 GAGGAGGACAAGGAAGAGGAGGG + Intronic
1023318824 7:38971338-38971360 AAGGAGAACAAAGAAGAAGGAGG - Intergenic
1023901112 7:44479850-44479872 AGGTAGAACAAGGAAAAGGATGG + Intronic
1023994575 7:45151423-45151445 ATGGATATCAAAGAAGAAGCAGG - Intergenic
1024922777 7:54577336-54577358 ATGGTGAAAAAGGAAGAGGCAGG - Intergenic
1025183928 7:56842209-56842231 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1025301174 7:57820712-57820734 AGGGAGGACAGGGCAGAGGCCGG - Intergenic
1025687998 7:63734763-63734785 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1026610405 7:71854206-71854228 ATGGAGAGAAAGAAACAGGCCGG + Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026920053 7:74148835-74148857 ATGGGCACCAAGGATGAGGCTGG + Intergenic
1027453958 7:78364032-78364054 ATAGAGAAGAAGGAGGAGGGAGG - Intronic
1027942450 7:84701553-84701575 ATGTAGACCAAGGAAGAAGACGG + Intergenic
1028395308 7:90362957-90362979 ATGGAAAACAAAAAAAAGGCAGG - Intronic
1028562929 7:92195299-92195321 ATGGGAAATAAGGAAGAGGTAGG - Intergenic
1029072580 7:97912034-97912056 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1029187284 7:98748279-98748301 AAGGAGAAAGAGGGAGAGGCAGG + Intergenic
1029504752 7:100956268-100956290 GTTGAGACCAAGGAAGAGGTGGG - Exonic
1030467605 7:109922861-109922883 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031624060 7:123971743-123971765 ATTCAAAATAAGGAAGAGGCTGG - Intergenic
1032140394 7:129324421-129324443 AACGAGAACAAAGAAGAGGTGGG - Intronic
1032490387 7:132319928-132319950 GTGGAGAACATGGGAGAGGTGGG - Intronic
1032495795 7:132361160-132361182 AGGGAAAACTAGGAAGAGGTAGG + Intronic
1032521776 7:132550930-132550952 ATGCAGGAGAAGGAAGAGGTGGG - Intronic
1032551773 7:132791041-132791063 ATGGAAAACAAGGACTTGGCAGG + Intronic
1032799843 7:135309184-135309206 AGGAAGAAGAAGGAAGAGGAAGG + Intergenic
1033069454 7:138188847-138188869 ATAGAGAACAAAGAATAGGCCGG + Intergenic
1033148039 7:138887958-138887980 AAGGAGAACAGGGAAGAGGACGG + Intronic
1033437802 7:141349798-141349820 AGGAAGAACAAGGCAGAGCCAGG + Intronic
1033619391 7:143048823-143048845 ATTGAAAGCAAAGAAGAGGCTGG - Intergenic
1033853612 7:145528507-145528529 ATACAGAAGAAGGAATAGGCAGG + Intergenic
1034191894 7:149219488-149219510 ATGCAGGACAGGGAAGAGCCTGG + Intronic
1034393345 7:150802033-150802055 AAGGAGAAAGAAGAAGAGGCAGG - Intronic
1034613519 7:152394164-152394186 AAGGAGATCAAGGAAGAAGCAGG - Intronic
1034703679 7:153120854-153120876 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1035533059 8:370392-370414 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1035775564 8:2185065-2185087 AGGGAAAAGAGGGAAGAGGCAGG + Intergenic
1036139468 8:6193385-6193407 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1036245086 8:7109268-7109290 AGGCAGAACAAGGAAAAGGATGG - Intergenic
1036255661 8:7204541-7204563 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1036361823 8:8082961-8082983 AGGCAGAACAAGGAAAAGGATGG - Intergenic
1036370365 8:8157012-8157034 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1036880526 8:12508619-12508641 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1036889145 8:12584054-12584076 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1036896733 8:12642196-12642218 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1036916640 8:12810716-12810738 AGGGAGAAGAAGGAAGGGGAGGG - Intergenic
1037249663 8:16877460-16877482 ATGGAGAGCAAGGAAAAGCAGGG - Intergenic
1037859108 8:22392230-22392252 ATGGGGAACTAGGAAGGTGCCGG + Intronic
1038276487 8:26125732-26125754 AAGGAGAAAAGGGAAGAGGTCGG + Intergenic
1038877516 8:31567668-31567690 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1038972894 8:32657357-32657379 CTGGAGAAGAAGGAATAGGTGGG - Intronic
1039292817 8:36115096-36115118 ATGGAGAACAGAGTAGCGGCTGG - Intergenic
1039440792 8:37594087-37594109 AGGGAGAAAAAGGCAGAGGGAGG + Intergenic
1039603001 8:38857557-38857579 ATACAAAATAAGGAAGAGGCTGG - Intergenic
1040041646 8:42921806-42921828 ATGGAGGAATAGGAAAAGGCTGG + Intronic
1040364635 8:46703086-46703108 ATGGATAACAAAAAAAAGGCAGG - Intergenic
1040488184 8:47894554-47894576 GTGGAGACCAAGGAAGAAGTAGG - Intronic
1041513150 8:58673126-58673148 CTGGAGAACAAAGGAGAGACTGG - Intergenic
1041860548 8:62508205-62508227 AGGAAGCACAAGGAAGAGGAAGG + Intronic
1042759580 8:72256758-72256780 ATGGAGAGCAAGGAAAAGTAGGG + Intergenic
1042966677 8:74361086-74361108 GTGGAGAAAAAGGAAGAGAAGGG - Intronic
1043306924 8:78806369-78806391 AGCGTGAACAAGGAAGAGGAGGG + Intergenic
1043360275 8:79464073-79464095 TTTGAGAACAAGAAAGAGGATGG - Intergenic
1043461621 8:80466207-80466229 ATGGAGAAAAAGTAAGTGGTGGG - Intergenic
1044135145 8:88576379-88576401 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1044451175 8:92336767-92336789 ATGGAGAACAAAGAAAAGCATGG - Intergenic
1044601230 8:94007448-94007470 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1045241313 8:100404115-100404137 ATGGAAAACAAAAAAAAGGCAGG + Intronic
1045294883 8:100864023-100864045 ATGGAGGATGAGGAAGAGGAAGG - Intergenic
1045366593 8:101482121-101482143 ATGGATAAAAAGGAAGTGGAGGG - Intergenic
1045483542 8:102612259-102612281 ATGGCGAGAGAGGAAGAGGCAGG + Intergenic
1045778312 8:105833212-105833234 GTGGAAAGAAAGGAAGAGGCAGG + Intergenic
1045828715 8:106432297-106432319 ATGGAGACCATGGAAGAGTGAGG - Intronic
1046581751 8:116101885-116101907 AGGGAGATAAAGGAAGAGGGAGG - Intergenic
1046739734 8:117815324-117815346 ATGGAGAATGAGGAAGATGTAGG + Intronic
1046750577 8:117922610-117922632 AAGGAGAACAAGAGAGAAGCTGG + Intronic
1046834822 8:118788615-118788637 ATCGAGAAAAAGGAGGAGACAGG - Intergenic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1047589932 8:126316884-126316906 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1047845784 8:128803530-128803552 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1047884655 8:129235879-129235901 ATGGAGAACCAAGAAAAGCCTGG - Intergenic
1048118609 8:131553802-131553824 ATGAAGAAGAAGGCAGTGGCTGG + Intergenic
1048126130 8:131637350-131637372 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1048829605 8:138463470-138463492 ATGGTGAAGCAGGAAGAGCCTGG + Intronic
1049209757 8:141380331-141380353 AACGAGAACGAGGACGAGGCTGG - Intergenic
1049261182 8:141640128-141640150 ATGGAGAACTTGAGAGAGGCTGG + Intergenic
1049414252 8:142488137-142488159 AAGGAGCACCAGGCAGAGGCTGG - Intronic
1050499958 9:6287261-6287283 ATAAAGCACAAGGAAGAGACCGG + Intergenic
1050983994 9:12058937-12058959 ATTGAGAACATGAAAGAGCCAGG + Intergenic
1051170283 9:14314194-14314216 ATGGGGGAGAAGGGAGAGGCCGG + Intronic
1052010015 9:23396512-23396534 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052243303 9:26301969-26301991 AAGGAGAAAGAGGAAGAGGGTGG - Intergenic
1053165176 9:35839451-35839473 GTGGAGACCAGGGAAGATGCAGG - Intronic
1053784577 9:41645063-41645085 ATGGAGGACAGAGCAGAGGCCGG - Intergenic
1054425633 9:65064172-65064194 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1054448163 9:65388085-65388107 ACGGAGGACAGAGAAGAGGCCGG - Intergenic
1054705674 9:68459325-68459347 ATGGGGAACAAGGAAGCTTCAGG - Intronic
1054718317 9:68579603-68579625 AAGGTGATCATGGAAGAGGCAGG - Intergenic
1054887050 9:70210456-70210478 ATGGAAAACAAGAAAAAGGCAGG - Intronic
1055200072 9:73648544-73648566 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1055629512 9:78209269-78209291 ATGGAGAACAAGTCAATGGCAGG + Intergenic
1055661967 9:78512781-78512803 ATAGAGAGCAATGAAGAGGAAGG - Intergenic
1055685285 9:78766817-78766839 ATGGAAAGCAAGGAGGAGCCAGG - Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055795703 9:79972677-79972699 AGGGAAAACAAGGCAGAGACAGG - Intergenic
1055807059 9:80107669-80107691 AAGTAGAGCAAGGAAGAGGAGGG + Intergenic
1055898905 9:81212036-81212058 ATGGAGATCTGGGAAGAGGTAGG + Intergenic
1055958698 9:81798915-81798937 ACGGAGAACAAGGAAGGGTGAGG - Intergenic
1056466910 9:86866096-86866118 ACTGAGAATAAGGAAGAGGTTGG + Intergenic
1056512828 9:87321869-87321891 ATGGAGTAGGAGGAAGGGGCTGG - Intergenic
1056995872 9:91458866-91458888 ATGGACACCAAGGATGAGGTTGG + Intergenic
1057307890 9:93922759-93922781 ACAGAGAAGAAGGAAGAGGGAGG + Intergenic
1057993530 9:99798218-99798240 ACCGTGAACAAGGAAGTGGCAGG - Intergenic
1058182076 9:101810306-101810328 CTGGAGAAGAAGGAAGAGAGAGG - Intergenic
1058370078 9:104256298-104256320 AGGGAGAACAAAGAAGAAGGGGG - Intergenic
1058848670 9:108988467-108988489 ATGGAGACAAGGGCAGAGGCAGG - Intronic
1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG + Intronic
1059086537 9:111309061-111309083 AGGGAGGTCAAGGAACAGGCTGG + Intergenic
1059256610 9:112936818-112936840 ATGGAGCACAAGGAATAGGAGGG + Intergenic
1059367674 9:113799384-113799406 CTGGTGAACAAGGAAGATGCAGG + Intergenic
1060114881 9:120932087-120932109 ATGGACAAGAAGGTAGAGGGTGG - Intergenic
1061105928 9:128530478-128530500 ATGGAGACAAAGGGAGAGTCAGG - Intronic
1061421510 9:130475212-130475234 ATGCAGAATGAGGAGGAGGCTGG + Intronic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1062376591 9:136264522-136264544 ACGGAGAAACAGGAAAAGGCAGG - Intergenic
1185499353 X:585159-585181 AGGGAGAAAAGGGAAGAGGGGGG + Intergenic
1185701178 X:2231545-2231567 AGAGAGAAAAAGGAAGAGGAAGG - Intronic
1185814985 X:3146310-3146332 AAGAAGAAGAAGGAAGAGGGAGG - Intergenic
1186311067 X:8319684-8319706 ATGGAGAAGAATAAACAGGCTGG - Intergenic
1186956357 X:14686638-14686660 ATGGAAAACAAAAAAAAGGCAGG - Intronic
1187069781 X:15877145-15877167 ATGGAGAAGTTGGAAGGGGCAGG + Intergenic
1187096197 X:16151024-16151046 ATGGAGACAAAGCAGGAGGCTGG + Intronic
1187344138 X:18447624-18447646 ATGGAGAACAAGGATGACAATGG - Intronic
1187705191 X:22003271-22003293 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188319986 X:28724418-28724440 ATGGAAAACAAAAAAAAGGCAGG - Intronic
1188369400 X:29350159-29350181 ATGTAGACCAAGGGAGGGGCTGG - Intronic
1188961711 X:36500979-36501001 AGGGTGAAGAGGGAAGAGGCAGG - Intergenic
1190288912 X:48978966-48978988 AGGGAGAAAATGGAAGAGGTTGG + Intronic
1190328357 X:49220493-49220515 GTGGAGAAAGAGGAAGAGGAGGG - Exonic
1190483594 X:50901822-50901844 ATGGAGCACAAAGAAGAGAATGG - Intergenic
1190630570 X:52381480-52381502 GTGGGGAACCAGGAAGGGGCAGG + Intergenic
1190680082 X:52819069-52819091 AAGGAATAGAAGGAAGAGGCAGG - Intergenic
1190788424 X:53676438-53676460 GTAGAGAAGAATGAAGAGGCAGG + Intronic
1190906611 X:54735293-54735315 ATGGAAAACAAGAAAAAGGAAGG - Intergenic
1190921517 X:54857760-54857782 ATGGAAAACAAGAAAAAGGCAGG - Intergenic
1190965916 X:55301476-55301498 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1191003328 X:55684978-55685000 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1191034296 X:56008371-56008393 ATGGAGAATAAGGAAAAGCAGGG + Intergenic
1191078959 X:56488148-56488170 ATGGAGAACAAAGAATAGTGAGG - Intergenic
1191186086 X:57613653-57613675 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1191748756 X:64518275-64518297 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1191785572 X:64914083-64914105 AGAGAGAAGAAGGAAGAGGAGGG - Intergenic
1191835172 X:65456296-65456318 ATGGAAAACAAAAAAAAGGCAGG + Intronic
1191956549 X:66648654-66648676 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1191971454 X:66821445-66821467 ATGCAGAGCAAGGTAGAGGAGGG + Intergenic
1192041785 X:67630462-67630484 ATGGAAAACAAAAAAAAGGCAGG - Intronic
1192740478 X:73887449-73887471 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1192802315 X:74478311-74478333 ATGGAAAACAAAAAAAAGGCAGG - Intronic
1193387753 X:80891442-80891464 ATGGAAAACAAAGAAAAAGCAGG - Intergenic
1193474126 X:81942532-81942554 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1193512679 X:82424347-82424369 ATGGAGTTCAATGATGAGGCTGG + Intergenic
1193621050 X:83752803-83752825 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1194451918 X:94054265-94054287 AGGCAGGACAAGGAACAGGCAGG - Intergenic
1194879809 X:99236918-99236940 ATGGACAACAAAAAAAAGGCAGG + Intergenic
1195009070 X:100717525-100717547 AGGGAGAATGCGGAAGAGGCAGG + Intronic
1195149465 X:102051151-102051173 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1195531418 X:105961892-105961914 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1195696773 X:107673289-107673311 CTGGAGAATCTGGAAGAGGCAGG - Intergenic
1195751618 X:108165359-108165381 ATGGAGAACGAGGTAAAGACAGG - Exonic
1195849195 X:109264694-109264716 AAAGAGAACAGGGAAGAGTCGGG - Intergenic
1195886792 X:109646840-109646862 ATGGAAAACAAAAAAAAGGCAGG + Intronic
1196050096 X:111295865-111295887 ATGGAGAAGAAGAAAGGGCCAGG + Exonic
1196146935 X:112328325-112328347 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1196205205 X:112931519-112931541 ATGGTGAACAAGAAAGAAGATGG - Intergenic
1196363816 X:114899666-114899688 ATGGAGAACAAAGAAAAGCCAGG - Intronic
1197676864 X:129339224-129339246 ATGGAAAACAAAAAAAAGGCAGG + Intergenic
1198806551 X:140500668-140500690 ATGTAAAACAAGGAAGAGGAGGG + Intergenic
1199133293 X:144220144-144220166 ATAGAGACAAAGGAAGAGGCAGG - Intergenic
1199512477 X:148638068-148638090 ATGGAAAACAAGGATATGGCAGG - Intronic
1199562751 X:149181994-149182016 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1200103674 X:153700935-153700957 ATGGACAAGAAGGAAGAGTAAGG - Exonic
1200414211 Y:2890864-2890886 AAGGAGGAGAAGGAAGAGGGAGG + Intronic
1200832385 Y:7699759-7699781 ATGGAAAACAGAGAAGAAGCCGG + Intergenic
1201146286 Y:11067095-11067117 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201146388 Y:11067409-11067431 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201146592 Y:11068049-11068071 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201146606 Y:11068098-11068120 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201418662 Y:13774533-13774555 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1201690995 Y:16764356-16764378 ATGGAAAACAACAAAAAGGCAGG + Intergenic
1201796006 Y:17896950-17896972 ATGGAAAACAAAAAAGAGGCAGG + Intergenic
1201805549 Y:18009035-18009057 ATGGAAAACAAAAAAGAGGCAGG - Intergenic
1201988081 Y:19991688-19991710 ATGGAGAACAAAAAAAAGGCAGG - Intergenic
1202055385 Y:20824823-20824845 ATGGAAAACAAAAAAAAGGCAGG - Intergenic
1202384490 Y:24312265-24312287 ATGGAGAACAAAGAGCAAGCTGG - Intergenic
1202486293 Y:25357857-25357879 ATGGAGAACAAAGAGCAAGCTGG + Intergenic