ID: 1021862821

View in Genome Browser
Species Human (GRCh38)
Location 7:24923731-24923753
Sequence CAGTGGGGCAGGCGGGCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021862813_1021862821 -4 Left 1021862813 7:24923712-24923734 CCAGGAAGATGCGGAGCTGCAGT 0: 1
1: 0
2: 1
3: 16
4: 175
Right 1021862821 7:24923731-24923753 CAGTGGGGCAGGCGGGCGGCCGG No data
1021862810_1021862821 7 Left 1021862810 7:24923701-24923723 CCCAAAGGAGACCAGGAAGATGC 0: 1
1: 0
2: 2
3: 14
4: 260
Right 1021862821 7:24923731-24923753 CAGTGGGGCAGGCGGGCGGCCGG No data
1021862811_1021862821 6 Left 1021862811 7:24923702-24923724 CCAAAGGAGACCAGGAAGATGCG 0: 1
1: 0
2: 0
3: 7
4: 146
Right 1021862821 7:24923731-24923753 CAGTGGGGCAGGCGGGCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021862821 Original CRISPR CAGTGGGGCAGGCGGGCGGC CGG Intronic
No off target data available for this crispr