ID: 1021868007

View in Genome Browser
Species Human (GRCh38)
Location 7:24978413-24978435
Sequence CTCATTAGGATGTAAGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021868007 Original CRISPR CTCATTAGGATGTAAGTACC AGG (reversed) Intronic
905193714 1:36257303-36257325 CTCACTAGAATGTCAGTTCCAGG + Intronic
907386771 1:54130835-54130857 CTCATGAAGATGAAGGTACCTGG + Intergenic
907746395 1:57217997-57218019 CTCATTAGACTGTGAGTTCCTGG - Intronic
909657601 1:78048053-78048075 TTTATTAGGATGTAACTTCCTGG + Intronic
910594358 1:88963060-88963082 CTCAGTAGGATATAAGTTCTAGG - Intronic
913277229 1:117150379-117150401 CTCAATGGGATTTAAGTTCCTGG + Intronic
913558554 1:119994913-119994935 CTAATAAGCATGGAAGTACCTGG + Intronic
913639287 1:120795558-120795580 CTAATAAGCATGGAAGTACCTGG - Intergenic
914279163 1:146154400-146154422 CTAATAAGCATGGAAGTACCTGG + Intronic
914540209 1:148605330-148605352 CTAATAAGCATGGAAGTACCTGG + Intronic
914626438 1:149465884-149465906 CTAATAAGCATGGAAGTACCTGG - Intergenic
916120031 1:161521228-161521250 CTCATTAGAATGTGAGCTCCAGG + Intronic
921784848 1:219217951-219217973 CACATTAGGATGTGAGTAAAGGG + Intergenic
922114412 1:222597661-222597683 CTCATTAAGATGTAAATTCGAGG + Intergenic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
923527373 1:234783042-234783064 CTCATTAGAATGTAGGGACTGGG - Intergenic
1065930703 10:30476238-30476260 CTGGTTAGGTTGTAACTACCAGG - Intergenic
1069444787 10:68463142-68463164 ATCATTAAGATGTAAAGACCTGG + Intronic
1072890490 10:99319433-99319455 CTCATTAGGATATAAAGTCCAGG - Intergenic
1073926565 10:108522793-108522815 CTCATATGGAAGCAAGTACCAGG - Intergenic
1075058141 10:119235354-119235376 CTCACTAGCATGTAAGTAATTGG + Intronic
1075512809 10:123085706-123085728 CTCATAAGAATTTAAGTGCCTGG + Intergenic
1075980149 10:126731322-126731344 CTCACTAGAATGTAAGCTCCAGG - Intergenic
1080578020 11:33617668-33617690 CTCATTAGGATGTAATCTCTAGG + Intronic
1089853454 11:121519659-121519681 ATAATTAGGTTGTAAGTACCTGG + Intronic
1093781723 12:23145155-23145177 CTCATTAGACTGTGAGTTCCAGG - Intergenic
1094074585 12:26458802-26458824 CTCATTAGGTAGGAAGTACTCGG - Intronic
1096963990 12:55610089-55610111 ATCAGTTGGATGTAAGTATCTGG + Intergenic
1099013789 12:77322484-77322506 CTCACTAGAATGTATGTACTAGG - Intergenic
1099618112 12:84964817-84964839 CACATAAGGGTGTAAATACCAGG + Intergenic
1101027766 12:100629932-100629954 ATCATTAGAATGTAAGCACCAGG + Intergenic
1102464632 12:113121335-113121357 CTCACTGGGTTGTAAGTTCCTGG - Intronic
1102562531 12:113772510-113772532 CCCACTAGAATGTAAGTTCCAGG - Intergenic
1103914357 12:124368812-124368834 CTCACTAGAATGTAAGTGCCTGG + Intronic
1106495829 13:30273598-30273620 CTGAGTAGAATGTAAGTAGCAGG - Intronic
1107778541 13:43874397-43874419 CCCATTAGAGTGTAAGCACCGGG + Intronic
1109030805 13:57184911-57184933 CCCATTAGGGTGTCAGTACTAGG - Intergenic
1112959414 13:105105184-105105206 CTCTTTCTGATGCAAGTACCAGG + Intergenic
1113684824 13:112275767-112275789 CTCATTAGAATCTAAGTACCAGG + Intergenic
1114410478 14:22496060-22496082 CCCAAGAGGATCTAAGTACCTGG + Intergenic
1115494792 14:33992426-33992448 CTAAGTAGGATGATAGTACCTGG + Intronic
1122016111 14:98798083-98798105 CCCATATGGATGTGAGTACCAGG - Intergenic
1125692770 15:41610132-41610154 CTCACCATAATGTAAGTACCTGG - Intergenic
1127821728 15:62663873-62663895 CTCATTATTATGTAAGTGACTGG - Intronic
1127943725 15:63728247-63728269 CTCACTAGCAGGTAAGCACCAGG - Intronic
1128910497 15:71509457-71509479 CTCATTAGCTTGTAAGTAAGTGG + Intronic
1130623656 15:85490791-85490813 CTCACTACAATGCAAGTACCAGG - Intronic
1133085902 16:3363317-3363339 CTCATCAGGATATAAATACAGGG - Intergenic
1133752310 16:8734297-8734319 CTCATGAAGATGTAAGCTCCAGG + Intronic
1134116222 16:11550796-11550818 CTCATCAGGATGAAAGTATGTGG - Intronic
1135195481 16:20390600-20390622 CTCACTAGGATGTCAGTTCCAGG + Intronic
1135911003 16:26560696-26560718 CCCAGGAGGATGTATGTACCTGG - Intergenic
1137462410 16:48677400-48677422 CTCATAAGGATTAAAGTAACTGG - Intergenic
1138503766 16:57465791-57465813 CTTATTAAAATGCAAGTACCTGG + Intronic
1140726148 16:77814441-77814463 CTCATTGGAATTTAAGTAGCTGG + Intronic
1141045944 16:80716248-80716270 ATAATTATGATGTAAGTACTTGG - Intronic
1150303302 17:64063896-64063918 CTCAGTACGGTGTAACTACCAGG + Intronic
1158198585 18:54915257-54915279 CTCACTAGGCAGTAAGTTCCAGG + Intronic
1162517298 19:11156128-11156150 CACTGTAGGATGTAAGTTCCAGG - Intergenic
1164858160 19:31541341-31541363 CTCATTGACATGGAAGTACCCGG - Intergenic
933234591 2:79850897-79850919 CTCATTAGGCTGTATCTATCTGG - Intronic
933689727 2:85170665-85170687 CTCATAAAGATCTTAGTACCCGG + Intronic
935185373 2:100727005-100727027 TTCATTAGCATGAAAGTACAAGG - Intergenic
937681884 2:124652777-124652799 GTCATTAGGGTGTCAGTATCCGG + Intronic
940760726 2:157735908-157735930 TTCATTAGGATGTATTTACTTGG - Intergenic
940976739 2:159954260-159954282 CTCATAAGTGTGTAAGTACCTGG + Intronic
941660863 2:168193908-168193930 CTTATTAGGAGGTGGGTACCTGG - Intronic
943903451 2:193470318-193470340 CCCATTAGGGTGTCAGCACCAGG + Intergenic
948370932 2:237488545-237488567 CTCCTTAGTATCTAAGTACCAGG + Intronic
948942615 2:241203809-241203831 CTCCCTAGGATGGAAGTTCCTGG - Intronic
1170623867 20:18016195-18016217 CACATTATGATGTAAGTTGCTGG - Intronic
1173545372 20:43893775-43893797 CTCTTTAGGATGGAAGAGCCTGG + Intergenic
1175380074 20:58556800-58556822 CCCATTAGGATGTAACCTCCAGG - Intergenic
1177060364 21:16366134-16366156 ATCATTCTGATGTAAGTAACAGG - Intergenic
1178059854 21:28840060-28840082 ATCATTTGGCTGTAAGTATCTGG - Intergenic
1178167827 21:30002087-30002109 AACATTAGGATGGAAGGACCGGG + Intergenic
1178293152 21:31386713-31386735 CTCCCTAAGATGTATGTACCTGG - Intronic
1178508320 21:33180870-33180892 CTCATTTATATGTATGTACCAGG - Intergenic
1182784634 22:32897165-32897187 CTCTCTAGAATGTGAGTACCTGG + Intronic
956037974 3:65116515-65116537 CACATTAAAATGTAAGCACCAGG - Intergenic
957972063 3:87395039-87395061 CTCAGTTGGCTGTAAGTACTTGG - Intergenic
958741123 3:98073790-98073812 CTCATTCTGAAGTGAGTACCTGG - Intergenic
959682292 3:109109291-109109313 CCCATTAGGATATATGTTCCAGG + Intronic
959915399 3:111811132-111811154 CTCAGGAGGATTTAAGTAACTGG + Intronic
960455002 3:117860190-117860212 GTCAGAAGGATGTGAGTACCAGG - Intergenic
967365367 3:188680672-188680694 ATCTTTAGGAAGTAAGTAACTGG + Intronic
972256116 4:37357663-37357685 CACATTAGAATGTAAGCTCCGGG - Intronic
972840506 4:42924690-42924712 CTAATTAGGAAGTAAGTTCTAGG - Intronic
974612290 4:64231952-64231974 CCCATTAGGGTGTCAGCACCAGG - Intergenic
975980042 4:80147063-80147085 GTCATAATGATGTAAATACCTGG - Intergenic
978634540 4:110788860-110788882 CTCATTAGACTGTGAGAACCTGG - Intergenic
978775512 4:112502473-112502495 CTCATTAGAATGTAAACTCCAGG - Intergenic
979166067 4:117533173-117533195 TTCATTATGCTGTAAGTCCCTGG - Intergenic
989079606 5:37603316-37603338 ATCAATTGGCTGTAAGTACCTGG - Intronic
989405878 5:41060108-41060130 CTTATTAGGATGGAGGAACCTGG - Intronic
992839519 5:80674098-80674120 CTGATCAGGCTGTAAGAACCTGG + Intronic
993896660 5:93543030-93543052 CTCATTAGGATTTACTGACCAGG + Intergenic
996998389 5:129726922-129726944 CCCATTAAGATGTAAGCTCCTGG + Intronic
998603527 5:143609588-143609610 ATCAATTGGATGTAAGTATCTGG - Intergenic
999845821 5:155478993-155479015 GTCATTAGAATATAAGTCCCAGG + Intergenic
1000039364 5:157473666-157473688 CTCCTTAGGATGTAAGTAGAGGG - Exonic
1000442155 5:161276841-161276863 CTCCTTATGATATAAGTCCCTGG - Intergenic
1006707403 6:36032730-36032752 CCCACTAGGCTGTAAGTTCCAGG - Intronic
1008735942 6:54544131-54544153 ATCATTTGGATGTAAGTATTTGG + Intergenic
1010294655 6:74182313-74182335 CTCATGAAGATGAGAGTACCTGG - Intergenic
1015892622 6:137983690-137983712 CTCACTAGGATGTCAGCCCCAGG + Intergenic
1017762025 6:157576696-157576718 TGCATTAGGATGTAAGTCACAGG - Intronic
1018718584 6:166555072-166555094 CTGCTTAGGATGTATGTTCCTGG - Intronic
1021868007 7:24978413-24978435 CTCATTAGGATGTAAGTACCAGG - Intronic
1029793909 7:102873953-102873975 CCCACTAGAATGTAAGTACTAGG + Intronic
1030677355 7:112398194-112398216 TTCTTAAGGATGAAAGTACCAGG + Intergenic
1037478405 8:19279970-19279992 CACAGTAGCATGTAAGTTCCTGG + Intergenic
1040741602 8:50582362-50582384 CTCACTAGAATGTAAGTTCTAGG - Intronic
1046552797 8:115738006-115738028 TTCATTAGAATGTAAGATCCAGG - Intronic
1047520489 8:125592056-125592078 CCCATTTGGATGTCAGTTCCTGG + Intergenic
1049787690 8:144458908-144458930 CTCACTCGGGTGTAAGTGCCGGG - Intronic
1052449194 9:28605530-28605552 CTCACTAAAATGTAAGTTCCTGG + Intronic
1053606505 9:39665759-39665781 CTTACTAGAATGTAAGTGCCAGG + Intergenic
1053864427 9:42422377-42422399 CTTACTAGAATGTAAGTGCCAGG + Intergenic
1054247036 9:62676664-62676686 CTTACTAGAATGTAAGTGCCAGG - Intergenic
1054561155 9:66711196-66711218 CTTACTAGAATGTAAGTGCCAGG - Intergenic
1055507644 9:76964536-76964558 CTCACTAGAATATAAGAACCAGG - Intergenic
1056946305 9:91000304-91000326 CTCCTGAAGATGTAATTACCCGG - Intergenic
1057516714 9:95728622-95728644 ATCATTGGCATGTAAGGACCTGG - Intergenic
1057841997 9:98493891-98493913 CCCATTAGAATGTAAGCTCCAGG - Intronic
1058732101 9:107860212-107860234 CTCATGCAGATGAAAGTACCAGG + Intergenic
1188898843 X:35703267-35703289 ATCATTATGATATAAATACCTGG - Intergenic
1191979472 X:66910199-66910221 CTCACTAAAATGTAAGCACCAGG - Intergenic
1192784888 X:74325932-74325954 CTCAGGAGGAAGTAAGCACCCGG - Intergenic