ID: 1021871174

View in Genome Browser
Species Human (GRCh38)
Location 7:25007655-25007677
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021871174_1021871177 2 Left 1021871174 7:25007655-25007677 CCAGGCTTCGCAATCCTGGGGTT No data
Right 1021871177 7:25007680-25007702 AACTGGATCACCAGTCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021871174 Original CRISPR AACCCCAGGATTGCGAAGCC TGG (reversed) Intergenic
No off target data available for this crispr