ID: 1021873140

View in Genome Browser
Species Human (GRCh38)
Location 7:25023252-25023274
Sequence TCACTTACAAGCGTGAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021873140_1021873144 30 Left 1021873140 7:25023252-25023274 CCACAGCTCACGCTTGTAAGTGA No data
Right 1021873144 7:25023305-25023327 AGTTACTTCATTTAGAATAATGG 0: 86
1: 1135
2: 1325
3: 1170
4: 2037

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021873140 Original CRISPR TCACTTACAAGCGTGAGCTG TGG (reversed) Intergenic
No off target data available for this crispr