ID: 1021880969

View in Genome Browser
Species Human (GRCh38)
Location 7:25095026-25095048
Sequence GTGAACAAAACCCAGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021880969_1021880971 -10 Left 1021880969 7:25095026-25095048 CCCACAGTCTGGGTTTTGTTCAC No data
Right 1021880971 7:25095039-25095061 TTTTGTTCACTGCACCTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021880969 Original CRISPR GTGAACAAAACCCAGACTGT GGG (reversed) Intergenic
No off target data available for this crispr