ID: 1021883776

View in Genome Browser
Species Human (GRCh38)
Location 7:25118638-25118660
Sequence AACAGGCATCTGGTCAGATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021883771_1021883776 0 Left 1021883771 7:25118615-25118637 CCCAATAAAGTTCTCTTTACAAA No data
Right 1021883776 7:25118638-25118660 AACAGGCATCTGGTCAGATTGGG No data
1021883769_1021883776 13 Left 1021883769 7:25118602-25118624 CCACTGCACCAAGCCCAATAAAG No data
Right 1021883776 7:25118638-25118660 AACAGGCATCTGGTCAGATTGGG No data
1021883772_1021883776 -1 Left 1021883772 7:25118616-25118638 CCAATAAAGTTCTCTTTACAAAA No data
Right 1021883776 7:25118638-25118660 AACAGGCATCTGGTCAGATTGGG No data
1021883770_1021883776 5 Left 1021883770 7:25118610-25118632 CCAAGCCCAATAAAGTTCTCTTT No data
Right 1021883776 7:25118638-25118660 AACAGGCATCTGGTCAGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021883776 Original CRISPR AACAGGCATCTGGTCAGATT GGG Intergenic
No off target data available for this crispr