ID: 1021884456

View in Genome Browser
Species Human (GRCh38)
Location 7:25125151-25125173
Sequence CTGGTTAGAGGCAGAGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021884456_1021884466 20 Left 1021884456 7:25125151-25125173 CCCACAGCTCTGCCTCTAACCAG 0: 1
1: 0
2: 1
3: 20
4: 228
Right 1021884466 7:25125194-25125216 TCTCACCTCTTTTTAGTCGCTGG 0: 1
1: 0
2: 1
3: 8
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021884456 Original CRISPR CTGGTTAGAGGCAGAGCTGT GGG (reversed) Intronic
900436418 1:2633296-2633318 GTGGTTAGGGGCAGAGCAGAGGG - Intergenic
900593839 1:3471576-3471598 CTGGCTGGGGGCAGAGCTGGGGG - Intronic
901199868 1:7460614-7460636 CAGGTGAGAGGCAGAACTGGGGG - Intronic
901506041 1:9686779-9686801 CTAGTTAGTGGCAGAGATGGAGG - Intronic
902314291 1:15606213-15606235 CAGCTGAGGGGCAGAGCTGTGGG + Intergenic
903303970 1:22399800-22399822 CTGATTATAAGCTGAGCTGTGGG - Intergenic
903499779 1:23794626-23794648 CTGGCTGGAGGCAGAGAAGTGGG - Intronic
903620775 1:24696432-24696454 CTGGTTAGCAGCTGTGCTGTTGG + Intergenic
903886530 1:26544090-26544112 GGGGTTAAGGGCAGAGCTGTGGG - Intronic
904747333 1:32719319-32719341 CTAGTTAGTGGCAGACCAGTTGG + Intergenic
904872081 1:33625239-33625261 CTGGTTCGAGGAACCGCTGTGGG + Exonic
905018928 1:34795181-34795203 CTTCTTAGAAGCAGAGCTGCTGG - Exonic
905167859 1:36093590-36093612 CTGGTTTGCTGCAGAGCCGTAGG + Exonic
905465941 1:38153305-38153327 CGGGATAGAGGCAGGGCTCTGGG + Intergenic
906041092 1:42788245-42788267 CTGGATGGAGGCAGAGCTGGAGG + Intronic
907458360 1:54590425-54590447 CCGGTTTGGGCCAGAGCTGTGGG + Intronic
911125403 1:94336848-94336870 CTGGTCAGTGACAGAGCTGGCGG + Intergenic
912050804 1:105525974-105525996 CTAGTTAGAGGCAGCTCTGATGG + Intergenic
914723733 1:150310213-150310235 CTGGGTAGAGGCAGTGATGGTGG - Intergenic
916106025 1:161433097-161433119 TTGGTCAGAGGCAATGCTGTTGG + Intergenic
917707722 1:177651185-177651207 CTTGTGAGAGACAGAGCAGTTGG + Intergenic
918342507 1:183579173-183579195 CCAGTTAGTGGCAGAGCTGTTGG - Intronic
919472739 1:197999191-197999213 CTGGTCAGAGGGAGAGATGAAGG - Intergenic
920451073 1:206061623-206061645 CTGGTTAGAGGCAGATGGCTGGG - Intronic
920564066 1:206959934-206959956 CTGGTTAGTGTCAGAGCTTGGGG + Intronic
920681051 1:208073002-208073024 CTGGTTAGTGGCAGAGCAGAAGG - Intronic
920970959 1:210743499-210743521 CTGGTTACAGCCTGAGCAGTGGG + Intronic
921600580 1:217102317-217102339 GTGGTGAGAGGCATAGCTCTGGG - Intronic
1063947554 10:11192275-11192297 CTGGAGGGAGGCAGTGCTGTGGG + Intronic
1068854007 10:61778275-61778297 CTATTAAGAGGCAGAGCTGAGGG - Intergenic
1069685834 10:70317877-70317899 CTGGCAGGAGGCAGAGCTTTGGG + Intronic
1069987473 10:72294227-72294249 CTGGTAAGGGTCAAAGCTGTGGG - Intergenic
1070085417 10:73232359-73232381 CTGCCCAGAGCCAGAGCTGTTGG - Intronic
1070173500 10:73950830-73950852 CTGGTGGGAGGCAGAGCGCTGGG + Intergenic
1071573397 10:86710048-86710070 CAGGTAAGAGGCAGAGCAGGAGG + Exonic
1071936963 10:90542655-90542677 ATGGTTAAGGGCAGAGATGTAGG - Intergenic
1072682546 10:97517374-97517396 CTGGGTAGAGGAGGAGCTGCTGG + Intronic
1073287836 10:102399263-102399285 GTGGATACAGGCAGGGCTGTGGG - Intronic
1074957952 10:118410934-118410956 CTGGAAAGCGGCAGTGCTGTGGG - Intergenic
1075051223 10:119183689-119183711 CTGGCTAGAAGCAGAGAGGTAGG + Intergenic
1075471587 10:122694653-122694675 CTGGTTGGGAACAGAGCTGTAGG + Intergenic
1075966571 10:126616925-126616947 CTGGTTAGAAGGGGAGGTGTGGG - Intronic
1076716764 10:132369874-132369896 CTGGTTACATGCAGAGCAGTGGG + Intronic
1076805817 10:132858342-132858364 CAGGTTGGAGGCAGGGCGGTGGG + Intronic
1076805840 10:132858397-132858419 CAGGTTGGAGGCAGGGCGGTGGG + Intronic
1076805862 10:132858452-132858474 CAGGTTTGGGGCAGGGCTGTGGG + Intronic
1077321659 11:1945632-1945654 GTGATTGGAGGCCGAGCTGTGGG - Intergenic
1078593442 11:12665821-12665843 CTGGTTAGAAGCAGAGAGGAGGG + Intergenic
1079173689 11:18119934-18119956 CTGGCTAGAAGCAGAGAGGTAGG - Intronic
1079503265 11:21126470-21126492 CTTGTAAGAGGCAGAGCTGCGGG - Intronic
1081365261 11:42227105-42227127 CTTGTTAGCTGCAGAACTGTGGG + Intergenic
1083732183 11:64658474-64658496 GTGGTTAGAAACAGAGCTGAGGG + Intronic
1086825787 11:91494080-91494102 GTGATTAGGGGAAGAGCTGTGGG + Intergenic
1089411519 11:118246998-118247020 CTGGTAAGAGTGGGAGCTGTGGG + Intronic
1091043700 11:132306418-132306440 CTGGTTGGAGGCACAGCTTCAGG - Intronic
1202804677 11_KI270721v1_random:945-967 GTGATTGGAGGCCGAGCTGTGGG - Intergenic
1092021409 12:5205651-5205673 CAAGTTAGAGGCATAGGTGTTGG + Intergenic
1092381250 12:7998803-7998825 CTAGGTAGAGGCAGCTCTGTTGG - Intergenic
1093785285 12:23185419-23185441 ATGGTCAGAGGCACACCTGTGGG - Intergenic
1095300220 12:40575634-40575656 GGTATTAGAGGCAGAGCTGTGGG - Intergenic
1096199790 12:49673429-49673451 CTGGCTTGGGGCAGATCTGTTGG - Intronic
1096614353 12:52823323-52823345 CTGGTTGGGGGCAGGGATGTGGG - Intronic
1097272196 12:57782963-57782985 CTGGGCAGAGGCAATGCTGTCGG - Intronic
1098131440 12:67354648-67354670 CTGGAAAGAGGCAGAGCTGAGGG + Intergenic
1102808487 12:115803110-115803132 CTCGGTAAAGACAGAGCTGTAGG + Intergenic
1103331671 12:120158532-120158554 CTGGTGCCAGGAAGAGCTGTCGG - Exonic
1104493760 12:129217587-129217609 CTGCTTAGAGGTTGAGGTGTTGG - Intronic
1104973608 12:132542333-132542355 CGGGTGAGAGGCCGAGCTGCTGG - Intronic
1108572608 13:51766312-51766334 CTGGTTAGAAGTAGAGCGGTGGG - Exonic
1109968606 13:69736529-69736551 CTGGGTAGAGGCCCAGCAGTGGG - Intronic
1112761104 13:102694408-102694430 CTGGTTAGAGGCTGAGAAGAAGG - Exonic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114513325 14:23280316-23280338 CTGGGGAGAAGCTGAGCTGTTGG - Intronic
1115950163 14:38712426-38712448 GTGGTGAGAGGCAGAGCTGGAGG - Intergenic
1118108742 14:62692348-62692370 GTGCTTAGAGGCAGAGATATGGG - Intergenic
1120973863 14:90231983-90232005 TTGGTCAGAGGCAATGCTGTTGG - Intergenic
1122814729 14:104306842-104306864 CTGGTCAGAGGTTGAGCTGGTGG + Intergenic
1122842965 14:104475729-104475751 CTGGTGAGAGGCAGATGTGAGGG - Intronic
1125202720 15:37114271-37114293 CGAGCTAGAGGCAGAGGTGTAGG + Intergenic
1125710294 15:41779776-41779798 CTGGTGAGGGGCATAGCTGCTGG - Intronic
1128543307 15:68551545-68551567 TTGGTTAGGGCCAGGGCTGTGGG - Intergenic
1128765526 15:70248836-70248858 CTGCTTGGGGGCAGAGCTGCTGG + Intergenic
1131160986 15:90104626-90104648 CTGGCCAGAGGCAGCACTGTAGG + Intergenic
1131394924 15:92078572-92078594 CTGGGCAAAGGCAGAGGTGTGGG - Intronic
1132065982 15:98731742-98731764 CTGGTTAGAGGCATACAGGTTGG + Intronic
1133334009 16:4994997-4995019 GTGGTCAGAGGCAGAGATGCTGG - Intronic
1134096853 16:11424027-11424049 CTGGGCAGAAGCAAAGCTGTTGG + Intronic
1134418042 16:14061659-14061681 CTGGTAAGTGGTAGAGCTGAGGG - Intergenic
1134579069 16:15356474-15356496 GAGGTTTGAGGCAGAGGTGTGGG + Intergenic
1134723517 16:16401076-16401098 GAGGTTTGAGGCAGAGGTGTGGG - Intergenic
1134881193 16:17746637-17746659 CTGGTAAGAGGCTGGGCAGTTGG + Intergenic
1134943912 16:18310794-18310816 GAGGTTTGAGGCAGAGGTGTGGG + Intergenic
1136099108 16:27980233-27980255 CTGGTTGGCAGCAGAGATGTGGG + Intronic
1136154978 16:28376413-28376435 GAGGTTTGAGGCAGAGGTGTGGG + Intergenic
1136208114 16:28738845-28738867 GAGGTTTGAGGCAGAGGTGTGGG - Intergenic
1141578749 16:84982866-84982888 CTGGTAAGGGGCAGAGCTGAAGG + Intronic
1144679703 17:17184800-17184822 CTGGGTAGAGACAGAGCAGGAGG - Intronic
1148804539 17:50257622-50257644 CTGGTTAGAGGGCGGGCAGTGGG - Intergenic
1148904810 17:50905303-50905325 CAGGTCAGAGGCAGAGGTGATGG - Intergenic
1149991548 17:61386364-61386386 CTGGAAGCAGGCAGAGCTGTGGG + Intronic
1150318649 17:64191214-64191236 ATGGTAAGAGTCAGAGATGTGGG - Intronic
1151116478 17:71740982-71741004 ATGGGCAGAGGCAGAGCTGGGGG - Intergenic
1151320964 17:73352206-73352228 CTGGGTAGGGGCAGAGCAGAGGG - Intronic
1151412467 17:73940470-73940492 CTGGTGGGTGGCAGAGCTGGGGG + Intergenic
1151492932 17:74443415-74443437 GTGGTGACAGGCAGAGCTGGAGG + Intronic
1152247643 17:79193511-79193533 GTGGATAGAGGCAGAGCAGGGGG - Intronic
1152272070 17:79330621-79330643 CTGGTGAGAGTCAGGGGTGTGGG - Intronic
1154030109 18:10746132-10746154 ATGGGTATAGGCAGCGCTGTAGG - Intronic
1154389185 18:13922014-13922036 CTGGGTAGGGGCAGAGCAGGGGG + Intergenic
1157535160 18:48452469-48452491 CTGGTCTGGGGCAGAGCTGGGGG + Intergenic
1160348933 18:78158135-78158157 CTAATTAGAGGCAGAGGTGGTGG - Intergenic
1160575070 18:79848644-79848666 CTGCCCAAAGGCAGAGCTGTGGG - Intergenic
1160801284 19:970879-970901 GTGGTCAGAGGCTGAGCTGAAGG + Intronic
1161007505 19:1943894-1943916 GTGGATGGAGGCAGCGCTGTGGG + Intronic
1162683737 19:12365244-12365266 CTGGGAAGACGCGGAGCTGTGGG + Intronic
1164831104 19:31321496-31321518 GAGGTTTCAGGCAGAGCTGTAGG - Intronic
1165411592 19:35665712-35665734 CTGGACCGAGGCAGAGCAGTGGG - Intergenic
925237641 2:2293440-2293462 TTGGTTAGAGGCAGATCTGCAGG + Intronic
926643599 2:15264375-15264397 CTGGTGGGATGCTGAGCTGTTGG - Intronic
927168568 2:20350265-20350287 GAGGTTAGAGACCGAGCTGTCGG - Intronic
927861186 2:26561283-26561305 CTGGTTGGAAAGAGAGCTGTAGG - Intergenic
930048417 2:47194221-47194243 CTGGTAGGAGGGGGAGCTGTAGG - Intergenic
932220983 2:69998846-69998868 CTGGCTAGAGGCAGGGCTCCGGG + Intergenic
932568364 2:72923820-72923842 CAGGGTAGAGGCAGGGCTGGGGG - Intronic
936951924 2:117986243-117986265 CACGGTAGAGGCAGAGCTGTTGG - Intronic
937645407 2:124260832-124260854 CTAACTAGAGTCAGAGCTGTGGG - Intronic
938839069 2:135140658-135140680 CTTGTTAGAGGCACAGCAGTGGG + Intronic
938970155 2:136424397-136424419 CTGGTGGGAGGCTGAGCTGGAGG - Intergenic
942574366 2:177347774-177347796 CTGATTTGAGGAAGAGCTGCAGG + Intronic
942998260 2:182291752-182291774 CTGGATAAAGACAGAGCTGGGGG + Intronic
944867948 2:203880777-203880799 CTGGCCAGAGGCAGGCCTGTTGG + Intergenic
944931967 2:204529171-204529193 CTGGATAGAGGCACAGCTGTGGG - Intergenic
945804374 2:214472185-214472207 CTGGTTAGGGGCATTGCTGCAGG - Intronic
947709523 2:232303945-232303967 AAGGCTAGAGGCACAGCTGTCGG + Intronic
1169090855 20:2860629-2860651 CAGGCTAGAGGCACATCTGTGGG - Intronic
1169967901 20:11237747-11237769 CTTCTAAGAGGCAGGGCTGTGGG - Intergenic
1172192623 20:33071122-33071144 CTGGATAGAGGCAGAGTGTTGGG + Intronic
1173709007 20:45138363-45138385 CTGTTCCGAGGCAGATCTGTGGG + Intergenic
1174754056 20:53140797-53140819 CTGGGAAGAGGGAGAGCTTTGGG + Intronic
1178796524 21:35749933-35749955 TTGGTTAGAGGCTGAGGTGAGGG - Intronic
1179909780 21:44441639-44441661 CTGGGCAGAGGCAGGGCTGGCGG + Intronic
1180793886 22:18592427-18592449 CAGGTTGGGGGCAGAGCTGGGGG - Intergenic
1181227854 22:21402893-21402915 CAGGTTGGGGGCAGAGCTGGGGG + Intergenic
1181250798 22:21531946-21531968 CAGGTTGGGGGCAGAGCTGGGGG - Intergenic
1181305506 22:21914985-21915007 CTGGTTAGAGGGTGAGTGGTGGG + Intergenic
1182362648 22:29756066-29756088 CTGGCCAAAGGCCGAGCTGTTGG - Intronic
1182867260 22:33614578-33614600 CTGGTCACAGGCAGAACTGAGGG - Intronic
1183009196 22:34931028-34931050 ACGGATGGAGGCAGAGCTGTGGG - Intergenic
1183687521 22:39369749-39369771 CCTGTGGGAGGCAGAGCTGTGGG + Intronic
1183736910 22:39649387-39649409 CTGGTTCCAGGCAGACCTGTGGG + Intronic
1183945952 22:41325830-41325852 CTGGTCAGAGGCAGCGTAGTCGG - Exonic
950085369 3:10253860-10253882 CTGGTAAATGGCCGAGCTGTGGG + Intronic
950197705 3:11020943-11020965 GAGATTAGAGGCAGAGATGTTGG - Intronic
951567155 3:24022268-24022290 CTGGTTTATGGTAGAGCTGTAGG + Intergenic
952294337 3:32048133-32048155 GTGGTTAGAGGAAGAGATGTGGG - Intronic
952621678 3:35351692-35351714 CTGGTTAGTTGGAGAGTTGTAGG - Intergenic
953607361 3:44420576-44420598 CTGGTTTGAGGAGGAGCTGCTGG - Intergenic
954005395 3:47586528-47586550 CTGGTTAGAGGCAAACCTGAGGG + Exonic
954794709 3:53155614-53155636 CTGGTTAGGGGCAGGGATCTGGG + Intergenic
959751717 3:109844868-109844890 GTGGTTAGAGGCTGGGCTGTGGG + Intergenic
960539035 3:118844349-118844371 CTAGTGGGAGGCAGAGCTGTGGG - Intergenic
961222778 3:125212927-125212949 CTGGGTAGGGGCAGGGCTGGGGG + Intergenic
961356562 3:126343410-126343432 CTGGTTGCAGGCAGAGTTTTGGG - Exonic
965373492 3:167893308-167893330 ATGTTTAGAGGCTGAGCTCTGGG + Intergenic
967770074 3:193324981-193325003 CTGGCCTGAGGCAAAGCTGTGGG + Exonic
967881551 3:194305403-194305425 CTGGTCCAAGGCAGAGCTGTGGG + Intergenic
968486669 4:866281-866303 CTGGTGGGAAACAGAGCTGTGGG - Intronic
971299873 4:25433263-25433285 GTGGTTGGAGGCAGAAGTGTAGG + Intergenic
972745913 4:41932699-41932721 CTGGATTGAGGCAGTGTTGTTGG - Intergenic
974107250 4:57484277-57484299 CTGGTTGGGGGCAGAGAGGTTGG + Intergenic
974318267 4:60310142-60310164 CCAGTAAGAGGCAGAACTGTTGG - Intergenic
975794853 4:77996521-77996543 CTGGTTAGTGTCCGAACTGTAGG - Intergenic
976256937 4:83109542-83109564 CTGTTGAGGGGCAGAGCCGTCGG + Intronic
978316159 4:107439783-107439805 CTGGTTTGAGGCCCAGCAGTTGG + Intergenic
979532668 4:121785641-121785663 CTGGAGTGAGGCAGGGCTGTTGG - Intergenic
985358539 4:189146891-189146913 CTGCTTAAAGGCAGAGGCGTGGG - Intergenic
986689860 5:10305431-10305453 CTTGTGTGAGGCAGAGCTGGAGG + Intronic
987017606 5:13836306-13836328 CTGGTTTGAGGCAGAGTTTGGGG + Intronic
987085048 5:14460379-14460401 CTGGAAAGTGGCAGAGCTGGTGG - Intronic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
988998490 5:36737577-36737599 CTGGTAAGAGGAACAGGTGTTGG - Intergenic
989132381 5:38120080-38120102 CTGTGTAAAGGCAGAGCTGCAGG - Intergenic
990568318 5:57052480-57052502 CTGCTTAGAAGGAGAGCTGATGG - Intergenic
992654277 5:78892828-78892850 CTGGTTAGTGTCTGAGCTGGTGG - Intronic
999702559 5:154241264-154241286 CAGCTGAGGGGCAGAGCTGTGGG + Intronic
1000291980 5:159879087-159879109 GTTGACAGAGGCAGAGCTGTGGG + Intergenic
1002880031 6:1242970-1242992 CTGGGAAGAAGCAGAGCTGGAGG + Intergenic
1003338351 6:5196149-5196171 CTGGGCAGAGGCAGTGCTGCGGG - Intronic
1004883464 6:20031072-20031094 CTGGATAGAGCCAGGGATGTTGG - Intergenic
1005490910 6:26346154-26346176 CTGGCTATAGGCTTAGCTGTTGG - Intergenic
1006229264 6:32568450-32568472 TTGGCCAGAGGCAGAACTGTTGG + Intronic
1006799128 6:36748298-36748320 CTGGAGGGAGGCAGGGCTGTGGG + Intronic
1008400914 6:51061658-51061680 CTGGGGAGAGGCAGATCTGCTGG + Intergenic
1011183920 6:84653164-84653186 CTTGTTAGAGACAGAGATATGGG - Intergenic
1012068478 6:94579835-94579857 CCTGTTAGTGGCAAAGCTGTGGG + Intergenic
1012966362 6:105678242-105678264 CTGGATAGAAACAGAGCTATGGG - Intergenic
1013531917 6:111027503-111027525 CTGGTAGGAGGCAAAGCAGTGGG + Intronic
1017740363 6:157400822-157400844 CTGGTAAGAGGCAGAGCCAAAGG - Intronic
1018700808 6:166424552-166424574 CTGGTTCCAGGCAGTGCTCTTGG - Intronic
1021049443 7:15964656-15964678 CTGGTTACAGGGAGATCTGAGGG + Intergenic
1021618147 7:22523687-22523709 CAGGTGAGAGGCAGGGGTGTGGG + Intronic
1021884456 7:25125151-25125173 CTGGTTAGAGGCAGAGCTGTGGG - Intronic
1022694562 7:32691650-32691672 CAGGTGAGAGGCAGAGGTGTGGG + Intergenic
1022927744 7:35073162-35073184 CAGGTGAGAGGCAGGGGTGTGGG + Intergenic
1023513693 7:40979411-40979433 CTGGTAAGAGCCAGAGCACTTGG - Intergenic
1025099563 7:56123515-56123537 CTGCTGAGAGTAAGAGCTGTGGG - Intergenic
1027797493 7:82712803-82712825 CTGGTTAGAGGCAATACTTTAGG + Intergenic
1029124689 7:98287943-98287965 CTGCTGAGAGGCAGGGCTGCAGG - Intronic
1029192174 7:98779626-98779648 ATGGACAGAGCCAGAGCTGTAGG - Intergenic
1030650897 7:112115000-112115022 CTGGAGAGAGGCAGGCCTGTTGG - Intronic
1030824163 7:114134278-114134300 ATATTTAGAGACAGAGCTGTGGG + Intronic
1030957172 7:115868578-115868600 CTGGTTGGAAGCAGATCTGCAGG + Intergenic
1031973411 7:128079335-128079357 CTGACTAGAGGCAAAGCTGTGGG + Intronic
1032998716 7:137478995-137479017 ATGGTTAGAGGCACAGCTCAGGG - Intronic
1034234751 7:149557885-149557907 CTGGTGAGCTGCAGAGCTGAGGG + Intergenic
1034415406 7:150961970-150961992 GTGGTGAGTGGAAGAGCTGTGGG - Intronic
1036733817 8:11289308-11289330 CTAGTAAGAGGCAGAACTGAAGG - Intronic
1037288432 8:17325304-17325326 ATGGTTGGAGGCAGAGCACTTGG - Intronic
1038449944 8:27633651-27633673 CGGGTTCGAGGCTGGGCTGTGGG + Intergenic
1041974386 8:63780478-63780500 CTGGTGACAGACAGACCTGTAGG + Intergenic
1044018483 8:87074936-87074958 GTGGTTAGAAGCAGAGATCTTGG + Intronic
1045373815 8:101551756-101551778 ATGGTCAGAGACAGAGCTGGTGG + Intronic
1045389506 8:101701426-101701448 CTGGGTAAATGCAGAGCTTTGGG + Intronic
1047300927 8:123612916-123612938 CTGGATGGAGCCAGAGCTCTGGG + Intergenic
1048610277 8:136014828-136014850 CTGGTTGGAGACAGAGCTTGAGG + Intergenic
1048949519 8:139483803-139483825 ATGGTTAGAGGAACAGATGTTGG - Intergenic
1049155998 8:141067227-141067249 CGGGAGGGAGGCAGAGCTGTGGG + Intergenic
1049293804 8:141818917-141818939 CTGGTTAGAGCCATAGATGATGG + Intergenic
1050260456 9:3836135-3836157 CTGGTTCTCAGCAGAGCTGTGGG - Intronic
1051167029 9:14273850-14273872 CTCCCAAGAGGCAGAGCTGTAGG + Intronic
1052523793 9:29585979-29586001 GTGGTTAGAGGAAGAGCAGGGGG + Intergenic
1053168765 9:35863474-35863496 CATGTTACAGGCAAAGCTGTAGG - Intergenic
1057140971 9:92726648-92726670 CTGGGTTGCTGCAGAGCTGTGGG - Intronic
1059406441 9:114100634-114100656 CAAGTTAGTGGCAGAGCTGGGGG - Intergenic
1060258454 9:122053180-122053202 CGGGGTAGAGGCAGATGTGTGGG + Intronic
1060284604 9:122238063-122238085 CTGGTTAATGGGAGAGCTTTAGG - Exonic
1062497039 9:136836782-136836804 CTGTTCTGAGGCACAGCTGTTGG - Intronic
1188821248 X:34777902-34777924 CTTGTTGTAGGCAGAGCTGGTGG + Intergenic
1189308936 X:40006684-40006706 CTGGCTAGGGGCAGAGTTTTGGG - Intergenic
1189908192 X:45783323-45783345 CTGCTCAGGGGCAGAGCTCTGGG + Intergenic
1190333876 X:49251269-49251291 CTGGTGGGAGGCAGAGGTGGTGG - Exonic
1190443261 X:50496916-50496938 CAGGAGAGAGGCACAGCTGTAGG + Intergenic
1192847933 X:74925128-74925150 CTAGATGGAGTCAGAGCTGTCGG + Exonic
1194225667 X:91253996-91254018 CTGGTTAGATGCTGAGTAGTGGG + Intergenic
1194845937 X:98809237-98809259 TTGGTGAGAGGCAGAGTGGTAGG - Intergenic
1195504457 X:105641484-105641506 CTGGATACAGGCAGATTTGTTGG + Intronic
1198380739 X:136081058-136081080 ATTGTCAGAGGCACAGCTGTAGG - Intergenic
1199951765 X:152713460-152713482 GGGGTTAGCGGCAGAGATGTTGG + Intergenic
1199957918 X:152754988-152755010 GGGGTTAGCGGCAGAGATGTTGG - Intergenic
1201017044 Y:9615452-9615474 TTGGTGAGAGACAGAGATGTGGG + Intergenic