ID: 1021884984

View in Genome Browser
Species Human (GRCh38)
Location 7:25129436-25129458
Sequence AGGGACAGGGCAGTGATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021884984_1021884990 10 Left 1021884984 7:25129436-25129458 CCTGCAATCACTGCCCTGTCCCT No data
Right 1021884990 7:25129469-25129491 CACTGATTCTCTATGCCATGTGG No data
1021884984_1021884993 22 Left 1021884984 7:25129436-25129458 CCTGCAATCACTGCCCTGTCCCT No data
Right 1021884993 7:25129481-25129503 ATGCCATGTGGCCACTGCTGGGG No data
1021884984_1021884992 21 Left 1021884984 7:25129436-25129458 CCTGCAATCACTGCCCTGTCCCT No data
Right 1021884992 7:25129480-25129502 TATGCCATGTGGCCACTGCTGGG No data
1021884984_1021884994 23 Left 1021884984 7:25129436-25129458 CCTGCAATCACTGCCCTGTCCCT No data
Right 1021884994 7:25129482-25129504 TGCCATGTGGCCACTGCTGGGGG 0: 7
1: 10
2: 27
3: 68
4: 371
1021884984_1021884996 29 Left 1021884984 7:25129436-25129458 CCTGCAATCACTGCCCTGTCCCT No data
Right 1021884996 7:25129488-25129510 GTGGCCACTGCTGGGGGATGTGG No data
1021884984_1021884991 20 Left 1021884984 7:25129436-25129458 CCTGCAATCACTGCCCTGTCCCT No data
Right 1021884991 7:25129479-25129501 CTATGCCATGTGGCCACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021884984 Original CRISPR AGGGACAGGGCAGTGATTGC AGG (reversed) Intergenic
No off target data available for this crispr