ID: 1021884993

View in Genome Browser
Species Human (GRCh38)
Location 7:25129481-25129503
Sequence ATGCCATGTGGCCACTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021884988_1021884993 2 Left 1021884988 7:25129456-25129478 CCTTCCGCAAGCACACTGATTCT No data
Right 1021884993 7:25129481-25129503 ATGCCATGTGGCCACTGCTGGGG No data
1021884989_1021884993 -2 Left 1021884989 7:25129460-25129482 CCGCAAGCACACTGATTCTCTAT No data
Right 1021884993 7:25129481-25129503 ATGCCATGTGGCCACTGCTGGGG No data
1021884984_1021884993 22 Left 1021884984 7:25129436-25129458 CCTGCAATCACTGCCCTGTCCCT No data
Right 1021884993 7:25129481-25129503 ATGCCATGTGGCCACTGCTGGGG No data
1021884986_1021884993 8 Left 1021884986 7:25129450-25129472 CCTGTCCCTTCCGCAAGCACACT No data
Right 1021884993 7:25129481-25129503 ATGCCATGTGGCCACTGCTGGGG No data
1021884985_1021884993 9 Left 1021884985 7:25129449-25129471 CCCTGTCCCTTCCGCAAGCACAC No data
Right 1021884993 7:25129481-25129503 ATGCCATGTGGCCACTGCTGGGG No data
1021884983_1021884993 23 Left 1021884983 7:25129435-25129457 CCCTGCAATCACTGCCCTGTCCC No data
Right 1021884993 7:25129481-25129503 ATGCCATGTGGCCACTGCTGGGG No data
1021884987_1021884993 3 Left 1021884987 7:25129455-25129477 CCCTTCCGCAAGCACACTGATTC No data
Right 1021884993 7:25129481-25129503 ATGCCATGTGGCCACTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021884993 Original CRISPR ATGCCATGTGGCCACTGCTG GGG Intergenic
No off target data available for this crispr