ID: 1021884994

View in Genome Browser
Species Human (GRCh38)
Location 7:25129482-25129504
Sequence TGCCATGTGGCCACTGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 7, 1: 10, 2: 27, 3: 68, 4: 371}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021884988_1021884994 3 Left 1021884988 7:25129456-25129478 CCTTCCGCAAGCACACTGATTCT No data
Right 1021884994 7:25129482-25129504 TGCCATGTGGCCACTGCTGGGGG 0: 7
1: 10
2: 27
3: 68
4: 371
1021884984_1021884994 23 Left 1021884984 7:25129436-25129458 CCTGCAATCACTGCCCTGTCCCT No data
Right 1021884994 7:25129482-25129504 TGCCATGTGGCCACTGCTGGGGG 0: 7
1: 10
2: 27
3: 68
4: 371
1021884985_1021884994 10 Left 1021884985 7:25129449-25129471 CCCTGTCCCTTCCGCAAGCACAC No data
Right 1021884994 7:25129482-25129504 TGCCATGTGGCCACTGCTGGGGG 0: 7
1: 10
2: 27
3: 68
4: 371
1021884983_1021884994 24 Left 1021884983 7:25129435-25129457 CCCTGCAATCACTGCCCTGTCCC No data
Right 1021884994 7:25129482-25129504 TGCCATGTGGCCACTGCTGGGGG 0: 7
1: 10
2: 27
3: 68
4: 371
1021884989_1021884994 -1 Left 1021884989 7:25129460-25129482 CCGCAAGCACACTGATTCTCTAT No data
Right 1021884994 7:25129482-25129504 TGCCATGTGGCCACTGCTGGGGG 0: 7
1: 10
2: 27
3: 68
4: 371
1021884987_1021884994 4 Left 1021884987 7:25129455-25129477 CCCTTCCGCAAGCACACTGATTC No data
Right 1021884994 7:25129482-25129504 TGCCATGTGGCCACTGCTGGGGG 0: 7
1: 10
2: 27
3: 68
4: 371
1021884986_1021884994 9 Left 1021884986 7:25129450-25129472 CCTGTCCCTTCCGCAAGCACACT No data
Right 1021884994 7:25129482-25129504 TGCCATGTGGCCACTGCTGGGGG 0: 7
1: 10
2: 27
3: 68
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021884994 Original CRISPR TGCCATGTGGCCACTGCTGG GGG Intergenic
900302709 1:1985993-1986015 GGCCATGTGGACACGGGTGGTGG + Intronic
901054724 1:6443828-6443850 TGCCATGCTGCCCCTGCTGCCGG - Intronic
901225692 1:7611785-7611807 TGCCCAGGGGCCAGTGCTGGGGG + Intronic
901656425 1:10772319-10772341 GGGCATGTGGCCAATGGTGGCGG - Intronic
903316105 1:22508622-22508644 AGCCATTTGGCAACTGCTGCTGG + Exonic
904330556 1:29755549-29755571 TGCCCTGCAGCCCCTGCTGGGGG - Intergenic
904416116 1:30362046-30362068 TGCCCTGCCGCCCCTGCTGGGGG + Intergenic
906108721 1:43309475-43309497 TGCCGTGTGTCCACATCTGGCGG + Exonic
906125899 1:43426716-43426738 TGCCGAGGGGCCACTGCTGGGGG + Exonic
906915374 1:50004079-50004101 TGCCATGTGGCTTCTGCCAGAGG - Intronic
907359676 1:53904415-53904437 TGCTATGCGGCAACTGCAGGTGG + Intronic
907588790 1:55645953-55645975 TGACATATGGCCTCTGCTTGTGG - Intergenic
908175716 1:61553229-61553251 TTCCATGAGGCCACTGCTAGAGG + Intergenic
908397701 1:63741262-63741284 TGCCCTGCAGCCACTGCTGGAGG + Intergenic
908793280 1:67804145-67804167 TGCCATGTGACCTCAGCTGCAGG - Intronic
908959030 1:69671856-69671878 TGCCATGTGGCCGCTGCTGGGGG + Intronic
909615582 1:77605185-77605207 TGCCTTGTGGTCACTGCTGGGGG - Intronic
909902965 1:81160872-81160894 TGCCATGTGGCCACTGCTGGGGG - Intergenic
910300343 1:85699466-85699488 TGCCAGATGTCCACTGCAGGAGG - Intronic
914756723 1:150566575-150566597 TGCTATGTTGCCCATGCTGGAGG + Intergenic
915313234 1:155014995-155015017 TGGCATGTTGGCGCTGCTGGTGG - Exonic
915830603 1:159126257-159126279 TGCACTGTGGCCACTGCTATAGG + Intronic
916651308 1:166837075-166837097 GGCCATGGGGCCTCTGCTGAAGG + Intergenic
917372912 1:174315650-174315672 TGCCATGTTGCCCATGCTGTAGG + Intronic
917387390 1:174491931-174491953 TGCCATGCAGCCACTGCTGGGGG + Intronic
917966968 1:180185049-180185071 AGTCATGGGGCCACTTCTGGAGG + Intronic
918536901 1:185584821-185584843 TGCAATGTGGCCACTGCCCCGGG - Intergenic
918690994 1:187479131-187479153 TGCCATGTGGCCAGTTTTGTTGG + Intergenic
919067653 1:192713848-192713870 TGCTACATGGCCACTGCTGGGGG - Intergenic
919455761 1:197818221-197818243 TGCCATGCAGCCACTGCTGGAGG - Intergenic
920181162 1:204132296-204132318 AGCCAGGTGGGCCCTGCTGGGGG + Intronic
920528109 1:206683751-206683773 TCCCCAGTGGCCACTTCTGGGGG + Intronic
921769642 1:219021433-219021455 TGCCATGCAGCCACTGCTAAGGG - Intergenic
922898930 1:229121526-229121548 TGTCAGGTGGCCCCTGCTCGTGG + Intergenic
923557067 1:235009704-235009726 TGCCAAGGAGGCACTGCTGGTGG + Intergenic
924598110 1:245464915-245464937 AGCCACGTGGACACTGCTGCAGG + Intronic
1063705858 10:8430213-8430235 TGCCAAGTGTCCCCTGGTGGGGG + Intergenic
1064446456 10:15398302-15398324 TGCAGTGTGGCCACTGCCAGGGG - Intergenic
1064521732 10:16209938-16209960 TGCCATGTGGCTGCTGCCAGAGG + Intergenic
1066471417 10:35701632-35701654 TGTCATGCCACCACTGCTGGTGG + Intergenic
1070556286 10:77530080-77530102 AACCATGTAGACACTGCTGGAGG - Intronic
1071237313 10:83664071-83664093 TGCCATGTGTCCACCTTTGGAGG - Intergenic
1071954687 10:90744693-90744715 AGCCATTTGGCCATTTCTGGAGG - Intronic
1072518161 10:96207323-96207345 TACTATGTGGCAGCTGCTGGGGG - Intronic
1072966560 10:99978768-99978790 TGCCATGTTGCCCAGGCTGGTGG + Intronic
1075057800 10:119233060-119233082 GGCCATTTGGCCACTGAGGGAGG - Intronic
1075416119 10:122265696-122265718 TGCCCTGTGCCCAGTGGTGGGGG - Intergenic
1075496251 10:122922113-122922135 TACCATGTAGCCACTGCAAGGGG - Intergenic
1075590200 10:123685505-123685527 TGCCACGTGGCCACTGGCGGGGG - Intronic
1076057558 10:127388036-127388058 GGCCATGTGTGCACTGCTGGAGG - Intronic
1077147111 11:1051256-1051278 TGCCAGGTGCCACCTGCTGGCGG + Intergenic
1077560308 11:3256455-3256477 TGCCTAGTGGCCCCTGCAGGGGG - Intergenic
1077566205 11:3302271-3302293 TGCCTAGTGGCCCCTGCAGGGGG - Intergenic
1077858756 11:6156758-6156780 TGTCACGTGGCCACTGCTGGGGG - Intergenic
1079003869 11:16779137-16779159 GGCAATGCGGCCGCTGCTGGGGG + Intronic
1079200291 11:18371225-18371247 TACTATGTGTCCACTGCTGCAGG - Intergenic
1079474007 11:20808843-20808865 TGCTATGTGGCTGCTGCTGGGGG + Intronic
1079689801 11:23405224-23405246 AGCCAAGTGGCCTCTGCAGGAGG + Intergenic
1079760152 11:24319198-24319220 TGCCATGCAGCCACTCCTAGGGG + Intergenic
1080350992 11:31385894-31385916 CGCCATGTGGCCACTGCAGGGGG - Intronic
1080386747 11:31814915-31814937 TGCCAAATGGCCAGTGCTAGGGG + Intronic
1080713375 11:34772229-34772251 TGCCATGCTGCCACAGCTGCTGG - Intergenic
1080785763 11:35473677-35473699 TACCATGTTGCCCCTCCTGGAGG + Intronic
1082909440 11:58353857-58353879 TGCCCTGTAGCTATTGCTGGAGG + Intergenic
1083512898 11:63227981-63228003 TGCCACATGGCCAGTGCTGGGGG + Intronic
1083846014 11:65334026-65334048 AGCCATGTTGCGACTCCTGGTGG + Intronic
1084431167 11:69112189-69112211 GGCCATGGGGCCACTCCTGTGGG - Intergenic
1084559219 11:69893300-69893322 TGCCATCTGGCCAAAGCAGGAGG + Intergenic
1085261244 11:75205899-75205921 GGCCAGGAAGCCACTGCTGGTGG - Exonic
1085296542 11:75434754-75434776 TGCCCTGTGGCCACTGATGTGGG + Exonic
1085562651 11:77486582-77486604 TGCCATGTGGCCACTGCCAGGGG - Intergenic
1085981741 11:81733865-81733887 CACCATGTAGCCACTGCTGGGGG + Intergenic
1087349920 11:97019103-97019125 TGCCCAGTGGCTGCTGCTGGGGG - Intergenic
1087691155 11:101321595-101321617 TGCCATGTGGTCACTTCCTGGGG + Intergenic
1087824505 11:102749614-102749636 TGCCATATGATCACTGCAGGGGG + Intergenic
1090217581 11:124983761-124983783 TGCCACGCTGCCACTGCTGCTGG - Intronic
1090473834 11:127002982-127003004 GGCCATGAGGCCAGTGTTGGGGG - Intronic
1091018827 11:132080314-132080336 GGCCATGTGGGCACAGCTGGTGG - Intronic
1091582589 12:1798237-1798259 TGCCATGTGCCCACCTCAGGAGG - Intronic
1091733811 12:2902451-2902473 TGCAATTTGGCCACTGATGCAGG - Intronic
1092284128 12:7119135-7119157 TGGGATGTGGCCTCTGCTGCTGG + Intergenic
1093531906 12:20175302-20175324 TGCCATTTGGCTGCTGCTGGCGG + Intergenic
1093619879 12:21276688-21276710 TGCCATGTGGCCACTGCTGGGGG - Intronic
1094816152 12:34186814-34186836 CACCTTGTGGCCACTACTGGTGG + Intergenic
1095100946 12:38183456-38183478 CACCATGTGGTCACTACTGGTGG - Intergenic
1095169583 12:39019076-39019098 TGCCAGGAGGTCGCTGCTGGGGG - Intergenic
1095624989 12:44304147-44304169 TGCCACGTGGCCACTGCTGGGGG - Intronic
1097161463 12:57049208-57049230 TGCCATGTGCCTACTGCATGGGG - Intronic
1098046588 12:66407490-66407512 TGCCATGTGGCTGCTGCAGAAGG - Intronic
1098667490 12:73181510-73181532 CACCATGTGGCTACTGGTGGGGG + Intergenic
1098977304 12:76916426-76916448 TGTCATGTGGACACTAGTGGTGG + Intergenic
1099024389 12:77447558-77447580 CTCCATGCAGCCACTGCTGGAGG - Intergenic
1099578114 12:84405680-84405702 TCCCATGAGGCCACTGGTGCAGG - Intergenic
1101252108 12:102946606-102946628 TGCCATGCGTCCACTGCTGCTGG + Intronic
1101906274 12:108828853-108828875 TCCCATGTGGCCAAGGCTGTAGG + Intronic
1103461178 12:121106432-121106454 TGCCACGGGGCTGCTGCTGGGGG - Intergenic
1103461247 12:121106848-121106870 TGCCACATGGCCACTGCCAGGGG - Intergenic
1106328227 13:28715298-28715320 TGACATGAGACCACTGCTGTGGG + Intronic
1109031818 13:57199946-57199968 TGCCATGTGACTACTGATGGAGG + Intergenic
1109100836 13:58181706-58181728 TGCCATGGAGCCACTGCTAGGGG + Intergenic
1109961769 13:69640072-69640094 TGCAACATGGCCACTGCTTGGGG + Intergenic
1110497862 13:76190271-76190293 TGCAGTGTCGGCACTGCTGGGGG - Intergenic
1111013665 13:82347691-82347713 TGCCATGTGGTCTCTGCTCATGG - Intergenic
1111572194 13:90103623-90103645 TGCCATATGGCCACTGCTGGGGG + Intergenic
1112254762 13:97819743-97819765 TGCCCTGTGGCAAGTGCTGCAGG - Intergenic
1113507407 13:110826763-110826785 TGCCAAGTGTCCAATGATGGTGG + Intergenic
1113507426 13:110826882-110826904 TGCCAAGTGTCCAGTGATGGTGG + Intergenic
1113937002 13:113999924-113999946 TGCCAGGGGGTCTCTGCTGGGGG + Intronic
1114652818 14:24296994-24297016 TGCCATGTTGCCTCTGCAGCAGG - Intronic
1114752358 14:25219174-25219196 TGCCATGTCACCAAGGCTGGTGG + Intergenic
1116021753 14:39469672-39469694 TGCCATGCAGCTGCTGCTGGAGG + Intergenic
1116691548 14:48113402-48113424 TGTCATTTGGCCACTGCTCTGGG - Intergenic
1117110255 14:52446212-52446234 TGCAGTGTGGCCACTGCCAGGGG - Intronic
1117161628 14:52995391-52995413 CACCATGTGGCCACTGCCAGGGG + Intergenic
1117384379 14:55195859-55195881 TACCACATGGCCACTGGTGGAGG + Intergenic
1117504556 14:56389158-56389180 TGCCACATGGCCACTGCTGGAGG + Intergenic
1117607117 14:57441005-57441027 TGCCATGTGGCTACTGCTGGGGG + Intergenic
1118096794 14:62546328-62546350 TGCCATGTGGCCACTGCCAGGGG - Intergenic
1118241292 14:64060979-64061001 TGCCATGCTGCTGCTGCTGGGGG + Intronic
1119587651 14:75851647-75851669 TGCACGGTGGCCCCTGCTGGAGG - Intronic
1119767930 14:77202046-77202068 TGCCCTGGGGCCCCTGCTGCAGG - Intronic
1120275589 14:82369553-82369575 TGTCACGTGGCCACTGCCAGTGG - Intergenic
1120867615 14:89309272-89309294 TGGCACGTGGCAACTCCTGGAGG - Intronic
1121217136 14:92257131-92257153 AGCCATGTGGATACAGCTGGAGG - Intergenic
1121394339 14:93606265-93606287 TTCCATCTGGCCACTTTTGGTGG - Intronic
1121526360 14:94621979-94622001 TGCCATGCAGCCACTGCAGCTGG + Intronic
1121664971 14:95665421-95665443 TGCCAGGTGGACACTGTTGGGGG + Intergenic
1122049186 14:99043490-99043512 AGAAATGTGGCCACTTCTGGAGG + Intergenic
1123106772 14:105845438-105845460 CGCCTTGGCGCCACTGCTGGAGG + Intergenic
1123117325 14:105900588-105900610 TGTCCAGTGGCCACTGCCGGAGG - Intergenic
1124069780 15:26380613-26380635 TGTCATGTGGCGAGTGGTGGTGG - Intergenic
1124378361 15:29143159-29143181 TGCTATGTGTCCAGTGCTGGTGG - Intronic
1124704734 15:31954273-31954295 TGGCATGTGGCCACTCCATGGGG + Intergenic
1126660841 15:51031520-51031542 TGCCACGTGGCCAGTGCTGGGGG + Intergenic
1126979954 15:54229206-54229228 TGCCATGTGGTCACTGCCAAGGG + Intronic
1128310771 15:66630698-66630720 TGGCATGTGGGCAGAGCTGGAGG + Intronic
1128912396 15:71527909-71527931 TGCCATGTTGCCCAGGCTGGTGG + Intronic
1129542402 15:76361247-76361269 TTCCATGTGGTCACAGTTGGAGG - Intronic
1129765498 15:78162991-78163013 CGCTATGTGGCCTCTGCTGATGG - Intronic
1130026789 15:80277148-80277170 TGCAATGTGGCCACTGCTGTTGG + Intergenic
1131315247 15:91329812-91329834 CGCCATGTGGTCACTGCTGGGGG + Intergenic
1131721264 15:95171100-95171122 GGCCCTGTGCACACTGCTGGAGG + Intergenic
1132543078 16:520412-520434 TGGGCTGTGGCCCCTGCTGGTGG - Intronic
1133498400 16:6342027-6342049 TAGCATGTGGACACTGTTGGGGG + Intronic
1134407172 16:13970630-13970652 TGCCACACAGCCACTGCTGGGGG + Intergenic
1136389308 16:29952351-29952373 TGCCATGCAGCTACTGCTAGGGG + Intronic
1136418745 16:30118941-30118963 TGCCATGTTGCCCAGGCTGGTGG - Intronic
1138228868 16:55323752-55323774 TGCCCCGCGGCCACTGCGGGAGG + Exonic
1138250292 16:55496959-55496981 GCCCATGGGGCCCCTGCTGGTGG + Exonic
1139005049 16:62559537-62559559 TGCCACATGGCTGCTGCTGGGGG + Intergenic
1139513275 16:67439273-67439295 TGCCATGTGCCCCATCCTGGAGG - Exonic
1139947369 16:70650452-70650474 TGCCTTGAGGCCACAGCTGCCGG + Intronic
1141141505 16:81499651-81499673 TGGCATGTGGCCTCTGCCCGGGG + Intronic
1141651986 16:85397668-85397690 TGCCATCTGGCCCCCTCTGGAGG + Intergenic
1142153435 16:88522686-88522708 TTTAAAGTGGCCACTGCTGGTGG + Intronic
1142555075 17:769630-769652 TGCCCTGGAACCACTGCTGGTGG - Intronic
1142886980 17:2919058-2919080 TGCCAGGTGCCCACAGCTGAGGG + Intronic
1142919130 17:3169297-3169319 CACCATGTAGCCACTGCTGGGGG - Intergenic
1143964478 17:10747176-10747198 TGCGATGTGGCTTCTGCAGGTGG + Intergenic
1144174557 17:12692616-12692638 TGCCACATGCCCGCTGCTGGTGG - Intronic
1144785546 17:17829573-17829595 GGCCATCTGGCCACAGATGGCGG - Intronic
1146098976 17:29960182-29960204 TACTGTGAGGCCACTGCTGGGGG + Intronic
1146462165 17:33054951-33054973 GGCCATGTGGCCAATGGTGATGG - Intronic
1146734094 17:35222470-35222492 CTCCATGTGGCCTCTGCAGGTGG - Intergenic
1147781207 17:42943592-42943614 TGCCATGTTGCCCAGGCTGGAGG + Intergenic
1147978942 17:44262993-44263015 TGACATGTGGCCCCCTCTGGAGG - Intronic
1148870962 17:50658610-50658632 TGCCCTGTGCCCACTGCGGTGGG - Intronic
1150380219 17:64714270-64714292 TGCAATGTGGCCACAGTGGGGGG - Intergenic
1150541382 17:66103774-66103796 TGCCATGTAGCCACTGCTGGGGG - Intronic
1151394499 17:73813282-73813304 GGCCAGGGTGCCACTGCTGGTGG + Intergenic
1151548690 17:74808837-74808859 TGCACTGTGGCCGCTGCAGGAGG - Intronic
1151968198 17:77443120-77443142 TGCAATGTGCCCAGTGCAGGAGG + Intronic
1152262389 17:79274124-79274146 AGACAGGTGGACACTGCTGGTGG - Intronic
1152571902 17:81124600-81124622 TGGCGTGTGGCCACTACAGGTGG + Intronic
1152583761 17:81180203-81180225 TCCCATCTGCCCAGTGCTGGGGG - Intergenic
1152822055 17:82442397-82442419 TGCCAGGGGGCTCCTGCTGGAGG + Exonic
1153075510 18:1157484-1157506 TACCAAGCTGCCACTGCTGGGGG - Intergenic
1156094146 18:33509563-33509585 TGCCATGGGGCCACTGCCTGGGG - Intergenic
1156259418 18:35430844-35430866 TGGCTGGTGCCCACTGCTGGTGG + Intergenic
1156337026 18:36181410-36181432 TGCCATGTGGCCAGGCATGGTGG - Intergenic
1156580261 18:38366869-38366891 TACCAGCTGGCCACTGCTGTAGG + Intergenic
1158892910 18:61889743-61889765 TGCCCTGTGGTCTCTGCTGCAGG + Intronic
1159024290 18:63168400-63168422 TGACAGGTGGCAGCTGCTGGTGG - Intronic
1159092150 18:63861334-63861356 TGCCATGTGGCCCCTGCTGGGGG + Intergenic
1159102007 18:63968360-63968382 GGCCATGTGGACGCTGTTGGTGG - Intronic
1159446196 18:68544488-68544510 CACCATGTGGCCACTGCTGATGG - Intergenic
1160408107 18:78656610-78656632 TTCCATGTGACCACTGCCTGAGG + Intergenic
1160424823 18:78772700-78772722 TGCCATGGGGCAGCTGCGGGAGG + Intergenic
1160579679 18:79876417-79876439 TGCGGCGTGGCCACTGCTGTGGG + Intronic
1160609962 18:80077281-80077303 TGCTATGTTGCCTCGGCTGGTGG - Intronic
1161077090 19:2291068-2291090 TGACAACTGGCCGCTGCTGGAGG - Exonic
1162596024 19:11629937-11629959 TGCCATTTGGCCTCTGCGAGAGG - Intergenic
1163233599 19:16019162-16019184 TGCCCTGTGGCCACAGCCTGCGG - Intergenic
1164958648 19:32407475-32407497 TCCCACGTGGCCACTTCTGTGGG + Intronic
1165323426 19:35100060-35100082 TGCCATGTGGGCCCAGCAGGTGG + Intergenic
1165685513 19:37816757-37816779 TGCTATGTTGCCCATGCTGGTGG + Intronic
1166074433 19:40405477-40405499 TCCCTTGGGGCCACTGCTGTGGG - Intronic
1166930313 19:46298030-46298052 TGCCCTGGGGCCGCTGCCGGGGG + Intronic
1167807661 19:51799782-51799804 TGACAGGGGGCCACTACTGGAGG + Intronic
1167816605 19:51887840-51887862 TGACCTGTCTCCACTGCTGGAGG + Intronic
925054426 2:846250-846272 TGGCATAGAGCCACTGCTGGAGG - Intergenic
925829661 2:7882039-7882061 TTACCTGTGACCACTGCTGGTGG - Intergenic
925867891 2:8244852-8244874 AGGGAGGTGGCCACTGCTGGAGG - Intergenic
926197714 2:10773816-10773838 TGCCCTGGGGCCCCTGCTGGGGG + Intronic
926314179 2:11697372-11697394 TGGCCTGTGGCCAGTGCAGGAGG + Intronic
926473651 2:13293873-13293895 AGCCATGAGGCCACTGCAGAGGG + Intergenic
927038718 2:19206504-19206526 TGCCATGTGACCAGTTCAGGTGG + Intergenic
927202892 2:20589456-20589478 TGCTAGGTGGGCACTGCTAGAGG + Intronic
927441528 2:23121920-23121942 TGCCAGGTGGGCACTGCGGGTGG + Intergenic
928483944 2:31710942-31710964 TGCCATGTGGCCAGTGATGGGGG - Intergenic
928715660 2:34056746-34056768 CACCATGCAGCCACTGCTGGGGG + Intergenic
928720795 2:34118605-34118627 TGCTCTGTGGCCCCGGCTGGAGG + Intergenic
929281848 2:40088253-40088275 TGCCACGGTTCCACTGCTGGGGG + Intergenic
929531156 2:42753714-42753736 TGCCAAGTGGCCGCTGTTGCTGG - Exonic
934897606 2:98132337-98132359 GGCCATGGGGCCCCAGCTGGAGG + Intronic
936349552 2:111702516-111702538 TCCCACGTGTCCACAGCTGGTGG + Intergenic
936415466 2:112305380-112305402 TTCTATGTGGCCACTGTGGGAGG + Intronic
936511414 2:113150464-113150486 TGCCACATGGCTGCTGCTGGGGG + Intergenic
937883676 2:126886272-126886294 GGCCAGGTGGCCGGTGCTGGAGG - Intergenic
937954831 2:127416281-127416303 TCCCAAGTGCCCAGTGCTGGGGG - Intergenic
938990442 2:136622926-136622948 TGCCATGCTGCCACAGCTGCTGG - Intergenic
939640016 2:144628969-144628991 TGCCATGTGGCAACTTGTTGTGG - Intergenic
939996261 2:148923006-148923028 TGCCATCTGGACAGAGCTGGGGG + Intronic
940052580 2:149479918-149479940 GGCTATGTGGCCAGTGCAGGGGG - Intergenic
942385622 2:175439628-175439650 TACCATGTGGCCACTGCCATGGG + Intergenic
942414796 2:175747226-175747248 TGCCATGTTGGCACTACCGGAGG + Intergenic
942862672 2:180635330-180635352 TGCCATGCGGCCACTGCTAGGGG - Intergenic
942972388 2:181971919-181971941 CACCACATGGCCACTGCTGGGGG + Intronic
943237338 2:185338893-185338915 TGCCATGTGGTCACTGCCAGTGG + Intergenic
943302609 2:186222950-186222972 TGTCATGTAGCCACTGCTGGGGG - Intergenic
943843115 2:192604603-192604625 AGCCCTGCTGCCACTGCTGGTGG - Intergenic
943844974 2:192634421-192634443 CACCATATGGCCACTGCTGGAGG - Intergenic
944085485 2:195842862-195842884 TGCAATTTGGCCTCTGATGGTGG + Intronic
944550140 2:200838268-200838290 TGGCATGTGGCCACTACTGGGGG - Intergenic
945001200 2:205352891-205352913 TATGATGTGGCCACTGGTGGGGG - Intronic
945022996 2:205592884-205592906 TGCCATGGGGCATCTGCTGCAGG - Intronic
945061040 2:205909144-205909166 TGACATGTGGCCAACGTTGGGGG + Intergenic
945711850 2:213306803-213306825 TGCCACTTGGCCACTGCCAGGGG + Intronic
945771150 2:214044679-214044701 TCCCATGTGGCCTCTGCCAGGGG - Intronic
946049221 2:216847910-216847932 TGCCACTTGGCTACTGCTGCTGG + Intergenic
947009283 2:225547662-225547684 TGCCATGTGGCCACTGCTGGGGG + Intronic
947017995 2:225642679-225642701 ATTCATGTGGCCACTTCTGGAGG + Intronic
947664987 2:231899824-231899846 TGCCATGTTGCCCAGGCTGGTGG - Intergenic
948223224 2:236289832-236289854 TGAGAGGTGGCCATTGCTGGAGG + Intergenic
948700008 2:239753506-239753528 TGCCATGAGGACAAGGCTGGGGG - Intergenic
948981270 2:241496125-241496147 AGCCATGTGGCCACTGAGGCCGG + Intronic
1169597170 20:7213821-7213843 TGCCATGTGGCCTCTGCGAGGGG - Intergenic
1170036702 20:11997211-11997233 TGCCCTGTTGCCAGTGTTGGTGG + Intergenic
1172217290 20:33244970-33244992 TGCAAAGTGTTCACTGCTGGGGG + Intergenic
1172894554 20:38291396-38291418 TGCCTTGTGGCCTCTGGAGGGGG - Intronic
1173709705 20:45143835-45143857 TGCCATGCAGCCTCTGCCGGGGG + Intergenic
1174695419 20:52551877-52551899 TGCCATGTGGCCACTGTGGGGGG + Intergenic
1175188985 20:57198693-57198715 TCCCATCTGGCCACGGGTGGTGG - Intronic
1175882350 20:62267824-62267846 TGACAAGTGGCAACTGCAGGAGG - Intronic
1176199829 20:63855256-63855278 TGCCCTGTGGCCACAGCTGGGGG - Intergenic
1176199860 20:63855353-63855375 TGCCCTGCGGCCACAGCTCGGGG - Intergenic
1176857574 21:13984830-13984852 TGCAACCTGGCCACTGCTGTAGG - Intergenic
1177105059 21:16945437-16945459 TGCCATGTGGCCACCACTAGAGG - Intergenic
1177494707 21:21873558-21873580 CACCACGTGGCCACTGCTGGCGG + Intergenic
1177593177 21:23200583-23200605 GGCAATATGGACACTGCTGGAGG + Intergenic
1178661198 21:34509309-34509331 TGCCATGTGGCCAGGACTTGAGG - Intergenic
1178702013 21:34841622-34841644 AGCAAGGTGGCCACTGCTGCCGG - Intronic
1181412511 22:22734247-22734269 TGCCATGTGCCCAGGCCTGGAGG + Intergenic
1182357164 22:29727421-29727443 TCCCAAGAGGTCACTGCTGGGGG + Intronic
1183299850 22:37053469-37053491 GGCCCTGTGGCCTCTGCTGTGGG + Intronic
1183400302 22:37599783-37599805 TGCCATGTTGCCCAGGCTGGTGG + Intergenic
1183403334 22:37617458-37617480 TGGTATGTGGCCCATGCTGGGGG - Intronic
1183696986 22:39429029-39429051 TGCTTTGTGGACACAGCTGGAGG - Intronic
1184319226 22:43726638-43726660 TGCCTTCTGGCCACTGTGGGAGG - Intronic
1184807604 22:46805609-46805631 GGCCACATGGCCACTCCTGGTGG + Intronic
1184924864 22:47629925-47629947 CGCCTTCTGGCCACTGTTGGGGG - Intergenic
1185077250 22:48690079-48690101 TGCCCTGTGGCATCAGCTGGAGG + Intronic
1185278236 22:49959057-49959079 TGCTGTGTGGATACTGCTGGAGG + Intergenic
1185398026 22:50602386-50602408 TGCCATGTGGCAAGTACTGGGGG + Intronic
949255704 3:2043428-2043450 TGCCATGTTGCCCAGGCTGGAGG - Intergenic
950459683 3:13113715-13113737 TGCCATGCGGCCCACGCTGGGGG - Intergenic
951181784 3:19667968-19667990 TGCCATATGGCCATTGCCAGAGG - Intergenic
951279677 3:20732392-20732414 TGCCATGTGACCTCTACTGGGGG + Intergenic
951437106 3:22677238-22677260 TGCCATGTGGCTGCTGATGAGGG + Intergenic
951658393 3:25034870-25034892 TTCCATGTGGCAACTGCAGCTGG + Intergenic
952645488 3:35652784-35652806 TACCATGTGGCCATTTGTGGAGG + Intronic
952688496 3:36176293-36176315 CACCATGTGGCTGCTGCTGGGGG + Intergenic
952902025 3:38116969-38116991 TGCCAGGTGGTCCCTGCTGGGGG + Exonic
953697797 3:45173275-45173297 ACCCATGTGGCCAGTGATGGAGG + Intergenic
955500162 3:59575244-59575266 TGCCTTCTGGCCTCTGCTGGAGG - Intergenic
957087170 3:75691926-75691948 CACCATGTAGCCACTACTGGTGG - Intergenic
957485580 3:80858363-80858385 TGCCATGTGGCCACTAAGAGGGG - Intergenic
958631310 3:96686631-96686653 CACCATGTGGCCACTGCCAGGGG + Intergenic
958682686 3:97352443-97352465 TGCCATGTGGCTGCTGCTGATGG - Intronic
958839394 3:99185876-99185898 TGCAATGTGGCTGCTCCTGGGGG - Intergenic
960972022 3:123146642-123146664 TGCCCTGTGGACATTACTGGAGG - Intronic
961710940 3:128827726-128827748 GGCCATGAGGCCACTGGTGCAGG + Intergenic
962291847 3:134144178-134144200 TGCCATGGGGACACAGCTGGGGG + Intronic
962855234 3:139339255-139339277 TGTCATGGGGCCACTGCTCTGGG + Intronic
964021667 3:152021028-152021050 TGCCATGCAACCACTGCTGGGGG - Intergenic
964179276 3:153864654-153864676 TGCCTTGTGGCTGCTGCTGGGGG - Intergenic
964259047 3:154812440-154812462 AGCCATGTGGCTGCTGGTGGTGG + Intergenic
964803984 3:160587093-160587115 CACCATGCAGCCACTGCTGGGGG - Intergenic
965060259 3:163775612-163775634 TTTCATGTGGTCACTTCTGGAGG + Intergenic
965099324 3:164276752-164276774 TGCCATGTGGCCACTGCCTGCGG - Intergenic
965547958 3:169934565-169934587 TACCATGTGGTCACTTCTGGGGG - Intronic
966878421 3:184336371-184336393 TGCCGTGTGCCCACTGCTCAGGG + Intronic
966995416 3:185275105-185275127 TGCCATGTTGCCCAGGCTGGTGG + Intronic
967050310 3:185777269-185777291 TGCCATGTTGCCCAGGCTGGTGG - Intronic
967636506 3:191808105-191808127 TGCCATGTGGCTGATGCTGTGGG - Intergenic
967677348 3:192316408-192316430 TGCCATGCAGCCACTAATGGGGG - Intronic
967949007 3:194825784-194825806 TGCCATGTGGCCAGTCAAGGTGG + Intergenic
968086589 3:195876696-195876718 TTCCCTGTGGCTGCTGCTGGTGG - Intronic
968433469 4:573137-573159 TGCTATGTGGATGCTGCTGGAGG - Intergenic
968556095 4:1247271-1247293 TGGCATCTGGTCACTCCTGGGGG - Intronic
968584966 4:1412056-1412078 TGCCATGTCCTCTCTGCTGGTGG + Intergenic
968643704 4:1728132-1728154 GGCGAAGTGGCCACTGCTGCGGG - Exonic
968759943 4:2437467-2437489 AGCCAGGTGGCCAGTGCTGCTGG + Intronic
969274220 4:6124278-6124300 TGCCAAGAGGTCACAGCTGGTGG + Intronic
969493454 4:7512793-7512815 GCCCATGTGTCCACTGGTGGGGG - Intronic
971095777 4:23400193-23400215 CACCACATGGCCACTGCTGGAGG + Intergenic
971914678 4:32852056-32852078 TGCCATGTGGCCATTGCTGGGGG + Intergenic
972271206 4:37512081-37512103 TACCATGTGGCCACTGCTGAAGG + Intronic
973763123 4:54139226-54139248 TGCTACATGGCCGCTGCTGGGGG - Intronic
973763194 4:54139625-54139647 CACCACATGGCCACTGCTGGGGG - Intronic
973784791 4:54324599-54324621 TGCCATGTGGCCTCTCCTTCTGG - Intergenic
974609207 4:64193262-64193284 TACCACATAGCCACTGCTGGGGG + Intergenic
977397166 4:96485127-96485149 TGCCATGTGGCTTCTGCTAGAGG + Intergenic
977839381 4:101683204-101683226 TGCCATATGGCAGCTGCTGCTGG + Intronic
979635159 4:122948764-122948786 TGCCATGTGGAAGTTGCTGGGGG - Intronic
980108814 4:128615008-128615030 TGCCATGTGGCAGTTGCTTGGGG - Intergenic
980875248 4:138655828-138655850 TGTCATGTTCCCACTGCTGGTGG - Intergenic
980956514 4:139434073-139434095 TGCCACGTGGCCACTGCTGGGGG + Intergenic
981203923 4:142016314-142016336 TGCCATGTTACTGCTGCTGGAGG + Intergenic
981530921 4:145752991-145753013 TGCCACGTGGCCGCTGCTGGGGG + Intronic
981728728 4:147875160-147875182 AGCCACGCAGCCACTGCTGGAGG - Intronic
982932562 4:161428026-161428048 TGCCATGTGGCTGCTGCTGAGGG - Intronic
983373555 4:166896343-166896365 TGCCTTGTGTCAGCTGCTGGAGG - Intronic
983492997 4:168411366-168411388 TGCCATGTGGCCACTGCTGGAGG - Intronic
983559352 4:169085581-169085603 TGCCATGTTGCCCAAGCTGGGGG - Intergenic
984220071 4:176964397-176964419 TGCCATGTTGCCACTGCCAGTGG - Intergenic
985519650 5:367566-367588 TGCCACGTGGGCCTTGCTGGGGG + Intronic
986756206 5:10839035-10839057 TGCCACAAGGTCACTGCTGGAGG - Intergenic
986860533 5:11921776-11921798 TGCCAATTGTCCACAGCTGGAGG + Intergenic
988082613 5:26432991-26433013 CACCATAAGGCCACTGCTGGGGG - Intergenic
990202974 5:53398357-53398379 TGCCATGTGGCAACTGTTGAGGG + Intergenic
990622217 5:57571818-57571840 TATCATGCAGCCACTGCTGGAGG - Intergenic
992531919 5:77660166-77660188 TGTCATGCAGCCACTGCTGTGGG + Intergenic
993171144 5:84420232-84420254 TGCCACATGGCCACTGTTGGAGG + Intergenic
993412538 5:87591521-87591543 TCCCATGAGGCCACTGGTGCAGG + Intergenic
994614685 5:102089538-102089560 CACCATGCTGCCACTGCTGGGGG + Intergenic
994894016 5:105678028-105678050 TGTCAAGTGGCTACTGATGGTGG - Intergenic
994970564 5:106731284-106731306 TGCCATGCTGCCACTGCTGCTGG + Intergenic
995290385 5:110444418-110444440 TACCATGTAGCCACAGCTGGGGG + Intronic
996653723 5:125914042-125914064 TGCCATATGGCCACTGCTATGGG + Intergenic
996722796 5:126646652-126646674 TGCCATGTTGCCCAGGCTGGTGG + Intergenic
996931748 5:128897007-128897029 TGCCATGCTGCCGCTGCTGGAGG + Intronic
997002922 5:129784034-129784056 TGCCATGTGGCCACTGCTGGAGG - Intergenic
997674093 5:135700048-135700070 GGCCATGTGTCAAATGCTGGTGG - Intergenic
998008671 5:138675411-138675433 AGCAATGTGGCCATTGCTAGAGG - Intronic
998020520 5:138766161-138766183 TGCTATGTGACAAGTGCTGGGGG + Intronic
998238091 5:140417646-140417668 TGCCATGTTGCCCAGGCTGGTGG + Intronic
998423291 5:142006525-142006547 AGCCCTGTGGCCACAGATGGTGG - Intronic
999125348 5:149242139-149242161 TGAGGTGTGGCCACTGGTGGAGG + Intronic
999849611 5:155523950-155523972 TGCCACTTGGCCACTGCTGGGGG + Intergenic
1000045535 5:157519064-157519086 TGCCATTTGGTTATTGCTGGAGG + Intronic
1001298388 5:170515390-170515412 TATCATGTAGCCTCTGCTGGAGG + Intronic
1001547875 5:172581650-172581672 TGCCCAGTGGGCAGTGCTGGAGG - Intergenic
1002427047 5:179182623-179182645 TGACATGTGGACCCTGCTGAGGG + Intronic
1005037537 6:21570402-21570424 TGCCATGTGGCCACTGCTGGGGG + Intergenic
1006301082 6:33193755-33193777 TGCTATGTGCCCAGGGCTGGAGG + Exonic
1008062654 6:47014765-47014787 TCCCCTGTAGCCACTGCTGCAGG + Exonic
1008227422 6:48937184-48937206 TGACCTGTGGCCACTTCTGGGGG + Intergenic
1009375383 6:62961762-62961784 TGCCACATGGCCACTGCCAGGGG + Intergenic
1011270955 6:85579555-85579577 TGACATGTGGCCACTTCTGGGGG - Intronic
1011820880 6:91252422-91252444 TGCCATGTTGCCACTGGAGAGGG + Intergenic
1012224368 6:96687945-96687967 TGACATGTGGCCGCTACAGGAGG - Intergenic
1013908442 6:115245886-115245908 TGCCCTGTAGCCACTGCCAGGGG - Intergenic
1014840913 6:126219053-126219075 TGCCATGTGGCCGCTGCCAGGGG + Intergenic
1016054851 6:139567570-139567592 TGCCATGCAGCCACTGCCAGGGG + Intergenic
1016061701 6:139637279-139637301 TGCCATGCAGTCACTGCTGTGGG + Intergenic
1016237681 6:141887737-141887759 TGCCATGCTGCCACAGCTGCTGG + Intergenic
1016472416 6:144388710-144388732 TGCCATGTTGCCCAGGCTGGTGG + Intronic
1016841698 6:148532266-148532288 TGCCATGTAGCCCAGGCTGGTGG + Intronic
1017022555 6:150152254-150152276 CGCCATGTGGCCTCTGACGGAGG - Intronic
1017318619 6:153062283-153062305 TCACACCTGGCCACTGCTGGGGG - Intronic
1019231149 6:170564820-170564842 TGCCATGTTGCCTGGGCTGGTGG - Intronic
1019971847 7:4547843-4547865 TGCCGTGTGTTCACTGCTAGGGG - Intergenic
1020574942 7:9914047-9914069 TGCCATGTGGCCACTGCTGAGGG + Intergenic
1021034683 7:15784109-15784131 TACTACATGGCCACTGCTGGGGG - Intergenic
1021231656 7:18092628-18092650 TGACAGGTGTCCACTGCTGAGGG + Intronic
1021884994 7:25129482-25129504 TGCCATGTGGCCACTGCTGGGGG + Intergenic
1022223709 7:28340977-28340999 TGCCACATGGCTACTGCTGGGGG + Intronic
1023716128 7:43046253-43046275 TACCATGCAGCCACTGCTGGGGG - Intergenic
1024094919 7:45975867-45975889 TGCTATGTGGACACTCCTGTAGG - Intergenic
1024662540 7:51511863-51511885 TACCATGTAGCCGCTGTTGGGGG + Intergenic
1027131057 7:75591752-75591774 GGCCATGTAGCTACTGCTGAGGG + Intronic
1027523944 7:79244403-79244425 CACCAGGTGGCCAATGCTGGAGG - Intronic
1027604756 7:80287254-80287276 TGCCATGCAGCCACTGCCAGGGG - Intergenic
1028094313 7:86741357-86741379 TGCCATGTGGAGGTTGCTGGGGG - Intronic
1030222328 7:107110057-107110079 CACCATGCGGCCACTGCTGGAGG - Intronic
1030368204 7:108670356-108670378 GGCGATGTTGCCACTACTGGGGG - Intergenic
1030391406 7:108932262-108932284 TGTCATGCAGCCACTGCTGAGGG + Intergenic
1030665511 7:112273406-112273428 GGCCACATGGCCACTGCTGGGGG + Intronic
1033542484 7:142369655-142369677 AGCCATATGGCCACTGCCAGGGG + Intergenic
1034126273 7:148674775-148674797 TGCCCTGTGGCCACTGCCAGGGG - Intergenic
1034398006 7:150842039-150842061 TGCCATGTAGCCACTGCCAGGGG - Intronic
1034901230 7:154909298-154909320 TGCCTTGTGGGCACTGTCGGTGG - Intergenic
1035686515 8:1527332-1527354 TGCCAGGTGGCCCCTCCCGGAGG - Intronic
1036214595 8:6868578-6868600 TCCCATGTGGCAACCACTGGCGG + Intergenic
1039447710 8:37646070-37646092 GGCCATGAGGACAGTGCTGGAGG + Intergenic
1041415878 8:57608689-57608711 TGCCATGGGGTCACTGCCAGAGG - Intergenic
1041692674 8:60704284-60704306 TACCATGTGCCCAAGGCTGGTGG + Intronic
1042382055 8:68128434-68128456 TGTCATCTGGCCATTTCTGGTGG + Intronic
1043554078 8:81409667-81409689 CACCATGCTGCCACTGCTGGAGG - Intergenic
1043641154 8:82452094-82452116 TGCCCTGTGCCCAGTGCTGATGG - Intergenic
1043859474 8:85299085-85299107 TGCCATGTTGCCCAGGCTGGAGG + Intergenic
1044153410 8:88811753-88811775 TCTCATGTGGCCAGTGGTGGTGG - Intergenic
1044649629 8:94480865-94480887 TGCCATGTTGCCCAGGCTGGAGG + Intergenic
1045041436 8:98228080-98228102 TGCCACTTGGCCACTGCTGGAGG + Intronic
1047005358 8:120614591-120614613 TGCCACATGGCCACGCCTGGAGG + Intronic
1047342941 8:124000226-124000248 CACCATTTGGCCACTGCTAGGGG + Intronic
1047448157 8:124938141-124938163 AGCACTGTGGCCCCTGCTGGTGG + Intergenic
1047548109 8:125839397-125839419 TGCACTGTGGCCTGTGCTGGGGG - Intergenic
1047721568 8:127644922-127644944 TGACATGTGACCACAGCAGGAGG - Intergenic
1047978493 8:130155554-130155576 TGCCATGTCGCCCAGGCTGGTGG + Intronic
1049182425 8:141229751-141229773 GGCCTTGTGGCCCCTGCTGTTGG - Intronic
1049192938 8:141298786-141298808 TGCCAGGTAGCTGCTGCTGGAGG - Intronic
1051099305 9:13502802-13502824 TGCTCTGTGGCCACTCCTGAAGG + Intergenic
1053298410 9:36931379-36931401 TGTCATGTGGCCAGTGATAGAGG - Intronic
1055342194 9:75295927-75295949 AGCTGTGGGGCCACTGCTGGGGG + Intergenic
1056516659 9:87358751-87358773 TGCCACATGGCTGCTGCTGGAGG - Intergenic
1057204042 9:93160117-93160139 TGCGCTGCGGCCCCTGCTGGCGG - Intergenic
1057453717 9:95188630-95188652 TGCCATGTGACCACCACTGAAGG - Intronic
1059406438 9:114100586-114100608 TTCCCTGTGGCCCCTGCTAGAGG - Intergenic
1061120157 9:128637060-128637082 AGTCATGAGGCCCCTGCTGGTGG - Intronic
1061133432 9:128720735-128720757 AGCCATGGGGCCACTGTTGTGGG + Exonic
1061152873 9:128838730-128838752 GGCCCTGTGGCAAATGCTGGTGG - Intronic
1061379351 9:130244767-130244789 TGCCCTGTGGCCACTGGGGCTGG - Intergenic
1186760587 X:12718103-12718125 TGGTATGTGGCCACTGAAGGTGG + Exonic
1186874379 X:13802893-13802915 TGCCGTGTGGGTTCTGCTGGTGG - Intronic
1187594958 X:20760706-20760728 TGCCATGGGGCTGCTGCTGGAGG + Intergenic
1187644235 X:21328957-21328979 TGCTATGCTGCCACTGCTGCTGG + Intergenic
1187772278 X:22713202-22713224 TGAGATGGTGCCACTGCTGGAGG + Intergenic
1188421238 X:29992568-29992590 TGCCATGAGGCCACTGCCAGGGG + Intergenic
1188554678 X:31398673-31398695 TGCTATGTTGCCAAGGCTGGAGG + Intronic
1188772863 X:34175694-34175716 TGCCATGTTGGCAAGGCTGGTGG - Intergenic
1188917989 X:35935421-35935443 TGCCATGCTGCCACTGCTGGGGG + Intronic
1189366398 X:40392271-40392293 TGCCATTTTGCCACTGCCTGGGG + Intergenic
1189891746 X:45610269-45610291 TGCCATGCTGCCAGTGCTGATGG - Intergenic
1190602765 X:52109182-52109204 TTCCATGTAGCCACTGCTGGGGG + Intergenic
1191119129 X:56884828-56884850 TGCCTCATGGCCAGTGCTGGGGG - Intergenic
1191943458 X:66504049-66504071 TTCCATGCAGCCACTGCTGAAGG - Intergenic
1191991884 X:67046671-67046693 TGACATGTGGCAACAGATGGAGG - Intergenic
1192304568 X:69945023-69945045 TGCCACATGGCCACTGTTGGGGG + Intronic
1192679836 X:73241184-73241206 TGCCATATCACCACTGCTGGAGG - Intergenic
1192841070 X:74856809-74856831 TGCCACACAGCCACTGCTGGGGG - Intronic
1192875358 X:75223695-75223717 TATCACGTGGTCACTGCTGGGGG + Intergenic
1193004934 X:76605963-76605985 TGCCACATGGCCGCTGCTGAGGG - Intergenic
1193098211 X:77577990-77578012 TGACACGTGGCCACTTCTGGGGG - Intronic
1193246929 X:79239833-79239855 TGTCATGTGGCCACTGCCAGGGG + Intergenic
1193280453 X:79642260-79642282 TGCCAAGTGGCTGCTGCTGAAGG + Intergenic
1193366839 X:80644405-80644427 TGCCATGCAGCCCCTGCTGGGGG + Intergenic
1193396500 X:80990184-80990206 TGTCATGTGGCCACTGCAAGGGG - Intergenic
1193563476 X:83048390-83048412 TGCCATGTAGCCACTGCTGGGGG + Intergenic
1194254957 X:91624133-91624155 TGCCATGTCCCCGCTTCTGGGGG + Intergenic
1194254986 X:91624320-91624342 TGGCATGAGGTCACTGCTAGTGG + Intergenic
1194783953 X:98058670-98058692 CACCATGTTGCCACTGCTGGAGG + Intergenic
1194882677 X:99273409-99273431 TGCCATGTGGCCACCGCTAGGGG - Intergenic
1196096888 X:111809514-111809536 TGCCATGCAGCCACTGCCAGAGG + Intronic
1196758336 X:119177549-119177571 AGCCATCTGGCCACTGCAGGAGG + Intergenic
1197382871 X:125766497-125766519 TGCCACATGGCCACTGCTAGGGG + Intergenic
1197587363 X:128364656-128364678 TGCCATGTGGCCACTATCTGGGG + Intergenic
1197590432 X:128402755-128402777 CACCATGCCGCCACTGCTGGAGG + Intergenic
1197655871 X:129115384-129115406 TGGCATCTAGACACTGCTGGTGG - Intergenic
1197670707 X:129273848-129273870 TGCCACATAGCCACTGCTGGAGG + Intergenic
1198515394 X:137401385-137401407 TACCATGTGGCTACTTCTGGGGG + Intergenic
1198663299 X:138995119-138995141 TGCCATGTGACCATTGCTAGGGG - Intronic
1199258430 X:145744011-145744033 TACCATGCTGCCACTGCTGCTGG - Intergenic
1199348603 X:146772745-146772767 GGCTATTTGGCCACTGCTGTTGG - Intergenic
1199455313 X:148021247-148021269 TGCCATGCAGCCACTGCTGGGGG + Intronic
1199944012 X:152651295-152651317 TGCCATGAAGCCACGGCTAGAGG + Intronic
1200559971 Y:4690087-4690109 TGCCATGCCTCCAATGCTGGTGG - Intergenic
1200573743 Y:4863736-4863758 TGCCATGTCCCCGCTTCTGGGGG + Intergenic
1200573771 Y:4863923-4863945 TGGCATGAGGTCACTGCTAGTGG + Intergenic
1201760958 Y:17537549-17537571 CACCACGTGGCCACTACTGGTGG + Intergenic
1201840594 Y:18368441-18368463 CACCACGTGGCCACTACTGGTGG - Intergenic
1202032923 Y:20596952-20596974 TGCCACACAGCCACTGCTGGTGG - Intergenic