ID: 1021886215

View in Genome Browser
Species Human (GRCh38)
Location 7:25142291-25142313
Sequence CATGGTAATCATCCAGTTCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021886211_1021886215 28 Left 1021886211 7:25142240-25142262 CCGGCTCTGGGTCAAATCCTATC 0: 1
1: 0
2: 0
3: 14
4: 164
Right 1021886215 7:25142291-25142313 CATGGTAATCATCCAGTTCAAGG 0: 1
1: 0
2: 1
3: 16
4: 110
1021886212_1021886215 11 Left 1021886212 7:25142257-25142279 CCTATCTTTCGTGTTAACTCTGC 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1021886215 7:25142291-25142313 CATGGTAATCATCCAGTTCAAGG 0: 1
1: 0
2: 1
3: 16
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021886215 Original CRISPR CATGGTAATCATCCAGTTCA AGG Exonic
902497446 1:16883578-16883600 AATGGAAATCATCCAGTTTGAGG + Intronic
903011249 1:20332091-20332113 CAAGATCATCATCCAGTCCATGG + Intronic
903456831 1:23493319-23493341 CAAGATAATCACCCATTTCAGGG + Intergenic
905897983 1:41561171-41561193 CATGGCAATCATTCATTTCATGG + Intronic
911605734 1:99903031-99903053 AATAGTAAGCATGCAGTTCATGG - Intronic
911776879 1:101825155-101825177 TAAGTTAATCACCCAGTTCAAGG - Exonic
912554590 1:110507030-110507052 AAAGTTAATCATCCAGTGCACGG + Intergenic
914007152 1:143742120-143742142 AATGGAAATCATCCAGTTTGAGG - Intergenic
914645971 1:149652610-149652632 AATGGAAATCATCCAGTTTGAGG - Intergenic
915366489 1:155319784-155319806 CAAGGTAATCATCCTGGGCAGGG - Exonic
919515678 1:198519575-198519597 CATGGTCATCTTCCTGTTGAAGG + Intergenic
920114372 1:203609645-203609667 CATGATACTGATTCAGTTCAAGG + Intergenic
1067839585 10:49665228-49665250 CATGGGAATCATCATTTTCAAGG + Intergenic
1067993355 10:51241015-51241037 CATAGTAAGCACCCAGCTCAAGG - Intronic
1069896788 10:71685036-71685058 CATGGGAGTCATTCAGGTCAGGG - Intronic
1070871920 10:79762305-79762327 CCTGACAATCATCCATTTCAAGG - Intergenic
1071638837 10:87284477-87284499 CCTGACAATCATCCATTTCAAGG - Intergenic
1071656401 10:87453475-87453497 CCTGACAATCATCCATTTCAAGG + Intergenic
1071730145 10:88239807-88239829 CATGGTTATCATCAAGTTGAGGG + Intergenic
1071877507 10:89857397-89857419 CATGGTGATCATAAATTTCATGG + Intergenic
1072799367 10:98382461-98382483 CATGATAAGCATTCAGTACATGG - Intergenic
1075905131 10:126074695-126074717 AATGGTCGTCATCCAATTCACGG + Intronic
1076410661 10:130246720-130246742 TATGGTGCTCATCCAGTTGAGGG + Intergenic
1077309314 11:1881456-1881478 CCTCGTCCTCATCCAGTTCAGGG - Exonic
1077795455 11:5486735-5486757 CATGGGCATCAGCCAGTGCAGGG - Intronic
1078583594 11:12559879-12559901 CATGATACTCATCCAGATAAAGG - Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1079357515 11:19742449-19742471 CATGGTCATCATCTAGCTCTGGG + Intronic
1083280747 11:61625947-61625969 CATGGTATTCCTCCATTCCACGG + Intergenic
1086414026 11:86570821-86570843 CATGGGATTCAGCCAGTACATGG + Intronic
1087006679 11:93478456-93478478 CATGATAAGCATCCAGTTTAAGG + Exonic
1089944197 11:122451117-122451139 CATGGCTATAATCCATTTCAAGG - Intergenic
1091562463 12:1625512-1625534 CATGGAAATCATCCAGTCTGAGG + Intronic
1094725774 12:33114227-33114249 CTGGGAAATCATCCATTTCAAGG - Intergenic
1097162245 12:57055443-57055465 CTGGGAAATCATCCAGTCCAAGG + Intergenic
1098989487 12:77049027-77049049 CATGGTGAAAATCCAGTTGAGGG - Intronic
1106630604 13:31467933-31467955 CAGGGTAATTACCTAGTTCAGGG + Intergenic
1109998027 13:70155168-70155190 CATGGTAATCGTGCAATTGATGG + Intergenic
1112262060 13:97886105-97886127 CATGGTCATCATCCATTCTAGGG - Intergenic
1113432506 13:110262819-110262841 CATGATAACCTTCCAGTTTACGG + Intronic
1115508789 14:34119448-34119470 CATGCTCATGATCCAGATCAAGG + Intronic
1117205305 14:53436465-53436487 CATAGTAAGCATTCAGTACATGG + Intergenic
1119902682 14:78274607-78274629 CATGGTCATCCTCAAGTCCAAGG - Intronic
1120961487 14:90128979-90129001 AATGATAATTACCCAGTTCAGGG - Intronic
1126997189 15:54458086-54458108 CATAATTATCATTCAGTTCAAGG + Intronic
1129083880 15:73067914-73067936 CTTGAAAATCATCCATTTCAGGG - Intronic
1132046676 15:98568884-98568906 AATGGTTTTCATCTAGTTCATGG + Intergenic
1148825570 17:50391114-50391136 CATGGAAAGCATCCAGGACAAGG + Intronic
1149283500 17:55134042-55134064 CATGGTAATGACCCAGTACAGGG + Intronic
1149333464 17:55609837-55609859 CATCATACTCATTCAGTTCAAGG - Intergenic
1151026945 17:70688142-70688164 CATGCTAATTCTCCATTTCAAGG + Intergenic
1153467311 18:5402925-5402947 TATAGTAATCATCTAGCTCAAGG + Intronic
1153534281 18:6084024-6084046 CATGTTAAGCATCCAGTTCAGGG - Intronic
1157967730 18:52227224-52227246 CATGGAAATCATCCTATTCAGGG + Intergenic
1163381986 19:16975231-16975253 CATCATAATCTTCCAGTTCCTGG + Exonic
1168543766 19:57233367-57233389 CACTGTAATCATACAATTCATGG + Intronic
925962196 2:9028022-9028044 CATGGTAAACATCCAGTAAATGG - Intergenic
928753741 2:34499676-34499698 GATGGTATTCATCCAGTAAAAGG + Intergenic
932021133 2:68088066-68088088 GATGGTAATGATCCATTTCTAGG + Intronic
932219803 2:69990820-69990842 CATGGTAATCATCAACTTCTTGG + Intergenic
933081522 2:77993742-77993764 CCTGGTAAGCAGCCAGTTTATGG - Intergenic
938047799 2:128138810-128138832 CATGATAATCATCCACTTCTTGG - Exonic
939014944 2:136891915-136891937 CATTGTAATCAGCTGGTTCAGGG + Intronic
939355601 2:141097974-141097996 AATGGTAATAATTCACTTCATGG + Intronic
940238924 2:151542082-151542104 CATGGCAATCATGAAGTTCTTGG - Intronic
941162150 2:162048137-162048159 CATGCTGATCACCCAATTCAGGG + Intronic
947707561 2:232288731-232288753 AATGGTAGGCATTCAGTTCATGG - Intronic
947931645 2:233969738-233969760 CAGGATAATCTTCCAGTTCTTGG - Exonic
1172647203 20:36478136-36478158 CATGGTGATCATCTTGTCCAGGG + Intronic
1175612845 20:60365668-60365690 CTTGGTAATCATCCTGTAAATGG - Intergenic
1176172664 20:63703165-63703187 CCTGGTCAGCATCCAGTTCTAGG - Intronic
1179084013 21:38201293-38201315 GATGGTACTCATCCAGATTAAGG - Intronic
1184027723 22:41870333-41870355 CATGGTGCTCAGCCAGGTCATGG - Intronic
950463340 3:13138630-13138652 CATGATCATCCTCTAGTTCAGGG + Intergenic
952058816 3:29481965-29481987 CATAGTAATCATACAGATCAAGG + Intronic
953685505 3:45075087-45075109 CATAGTAATCATTCAATACATGG + Intergenic
955705515 3:61723803-61723825 CATGGGAATCATCCAGTATCTGG - Intronic
956024895 3:64972707-64972729 CACGTTAATCCTCCAATTCAGGG + Intergenic
960864593 3:122186244-122186266 CATGGTTGGGATCCAGTTCAAGG - Intronic
964366361 3:155954644-155954666 CATTTTCATTATCCAGTTCATGG + Intergenic
964656167 3:159068127-159068149 CATGGGAGTCATTCTGTTCAAGG - Intronic
967100632 3:186212516-186212538 CATGGCAATCCTTCAGTTAAGGG + Intronic
967599458 3:191367802-191367824 CTTAGTAAACATACAGTTCAAGG + Intronic
969177448 4:5409577-5409599 CATGGAAAGCATGCAGTCCAAGG - Intronic
971504218 4:27348456-27348478 CATGGTAAGCATCCAATAAATGG - Intergenic
975746954 4:77484306-77484328 CATGGTAATTGCCCTGTTCAAGG + Intergenic
978896508 4:113894972-113894994 CATTGTAACTATACAGTTCAGGG + Intergenic
982527142 4:156492026-156492048 GATGGTAACCATCCAGATTAAGG - Intergenic
986812493 5:11374739-11374761 CATGGAAATAATCCAGAACAAGG + Intronic
994173805 5:96688026-96688048 CATGTTAACCATATAGTTCAGGG + Intronic
995243236 5:109909051-109909073 CATGGGAATGATCCAGTTGATGG - Intergenic
1001946095 5:175779295-175779317 CATGGAACTCATCCAGGGCATGG + Intergenic
1004257095 6:14074538-14074560 CATGGGAATGATCCAGTTAAAGG + Intergenic
1005929599 6:30473868-30473890 CACTATAATCATTCAGTTCAAGG - Intergenic
1006164974 6:32058878-32058900 CATTGTAATCATTCACCTCACGG - Intronic
1007306094 6:40906277-40906299 CATAGGAACCATCCAGTCCAAGG - Intergenic
1008148040 6:47915981-47916003 CAGTGTTATCATCCAGTGCATGG + Intronic
1008928954 6:56916939-56916961 CTTGGCAAGCATCCATTTCATGG - Intronic
1010558643 6:77318459-77318481 CTTGGAAATCATCCAGAACAAGG - Intergenic
1011672474 6:89696186-89696208 CATGGGAACCAGCCAGCTCACGG + Intronic
1012543020 6:100383682-100383704 CATGGTAATCATTCAATCCACGG - Intergenic
1013908468 6:115246061-115246083 CAAGGGAATCACCCATTTCAAGG + Intergenic
1016031038 6:139338466-139338488 CATTGTTATGATCCAGTTCTAGG - Intergenic
1019849452 7:3539702-3539724 CATGGCAGTCATCCACATCAGGG + Intronic
1020560936 7:9728118-9728140 CATCATAATCTTCCAGTTCCTGG - Intergenic
1021886215 7:25142291-25142313 CATGGTAATCATCCAGTTCAAGG + Exonic
1024116180 7:46196103-46196125 CATGGTCAACATCCAGGTCAAGG - Intergenic
1028772565 7:94643007-94643029 TATGGTAACTACCCAGTTCATGG - Intronic
1030875493 7:114808366-114808388 CATGTTAATAATCCAATTTATGG - Intergenic
1032542269 7:132712978-132713000 CATGGTCATCACCCAGTGAAGGG - Intronic
1033228088 7:139576491-139576513 CATGGAAGCCATCCAGCTCAGGG - Intronic
1035796032 8:2357537-2357559 CTGGGTGATCATCCAGTGCATGG - Intergenic
1038176611 8:25185889-25185911 CATTGTAATCACCCCGTTCAGGG - Intronic
1039406403 8:37316525-37316547 GATGTTTATCCTCCAGTTCAGGG - Intergenic
1041601852 8:59727807-59727829 CATGGTCAACTTCCAGTTTATGG + Intergenic
1042876906 8:73448668-73448690 CATGGGACTCATCCACGTCACGG + Intronic
1045314699 8:101033342-101033364 CATGGTAGTAAACCAGCTCAAGG + Intergenic
1056940769 9:90954149-90954171 AATGGGATTCATCCAGCTCAGGG + Intergenic
1059841040 9:118216782-118216804 CATGGTAAATATCTAGTTCAAGG + Intergenic
1059889178 9:118782254-118782276 TAGGGAAATCATCCAGTCCATGG - Intergenic
1060291815 9:122310052-122310074 CATGGGAAGCATCCAGTACAAGG - Intronic
1185822173 X:3216039-3216061 CTTGGTAAACATCCCATTCAAGG + Intergenic
1186946346 X:14572381-14572403 CTTCGAGATCATCCAGTTCAAGG - Intronic
1190231131 X:48582664-48582686 CATTGAAATCATCCGGTTTATGG + Intergenic
1193050810 X:77097415-77097437 CATGGTAACCACCCAGTAAATGG + Intergenic
1194222862 X:91217122-91217144 AATGGTAAAAATCCAGTTTATGG - Intergenic
1198693711 X:139312950-139312972 CATGGTAATCGTACAGTAAATGG - Intergenic
1200559341 Y:4680578-4680600 AATGGTAAAAATCCAGTTTATGG - Intergenic