ID: 1021888399

View in Genome Browser
Species Human (GRCh38)
Location 7:25163391-25163413
Sequence CTCCAGGGCCATTCGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021888399 Original CRISPR CTCCAGGGCCATTCGGAGGC TGG (reversed) Intronic
900038880 1:440548-440570 CTCCATGGACTCTCGGAGGCCGG + Intergenic
900777829 1:4598037-4598059 CAACAGGGCCTTTCGGAGGGTGG + Intergenic
902386804 1:16080551-16080573 CTTCAGGGCGATTCTGAGCCTGG + Intergenic
902728419 1:18352469-18352491 CTCCCGGGTGATTCGGATGCTGG + Intronic
903705957 1:25286143-25286165 CTCCAGGGCCAATCGGGAGCTGG - Intronic
907458343 1:54590381-54590403 CTCCGGGGCCCTGAGGAGGCTGG + Intronic
909427573 1:75545013-75545035 CACCAGGGCCTTTTGGAGGGTGG - Intronic
910521501 1:88127135-88127157 CTCCAGACCCATTCTGAAGCAGG + Intergenic
910755167 1:90682044-90682066 CTCCAGGCCCATTCTGCTGCAGG - Intergenic
912048887 1:105497691-105497713 CTCCATGGCCCTTTGGTGGCTGG - Intergenic
912900352 1:113640710-113640732 CACCAGGGCCAGTCGGGGGTTGG + Intronic
914885735 1:151582890-151582912 CTGCAGGGTCATTCAGAGCCAGG - Exonic
918070437 1:181130257-181130279 CTGCAGGGACATTTTGAGGCAGG - Intergenic
923945424 1:238881288-238881310 CACCAGGGCCTTTCGGTGGGTGG + Intergenic
1067583131 10:47458017-47458039 GTCCAGGGCCATGGTGAGGCTGG + Intergenic
1069910465 10:71755657-71755679 CTCCAGGGGCATAGGGCGGCAGG - Intronic
1071844869 10:89511565-89511587 CACCAGGGCCTGTCGGAGGGTGG + Intronic
1073073976 10:100811947-100811969 CTCCAGGGCCAGGAGGTGGCAGG - Intronic
1073477883 10:103766257-103766279 GTCCAGGGCCAGTCTGAGCCCGG + Intronic
1074536236 10:114330233-114330255 GTCCAGAGCCATTCTGGGGCTGG + Intronic
1075665188 10:124224722-124224744 CTCCAGTGCCATTCCCAGTCTGG + Intergenic
1076705987 10:132301852-132301874 CTCCAGGCCCATCGGGAGCCCGG + Intronic
1076965087 11:76459-76481 CTCCATGGACTCTCGGAGGCCGG + Intergenic
1077425472 11:2473965-2473987 CTGCAGGGCCCTTGGGAGGGAGG + Intronic
1082688846 11:56275270-56275292 CGCCAGGGCCGGTCGGAGGGTGG - Intergenic
1082951847 11:58825304-58825326 CACCAGGGCCTGTCGGGGGCTGG - Intergenic
1083317937 11:61827934-61827956 CTCCTGGGCCAATGGCAGGCGGG + Exonic
1083319248 11:61835072-61835094 TTCCAGGGCCCTGGGGAGGCAGG - Intronic
1084746451 11:71172972-71172994 CTCCGGGGCCATTGGGCTGCTGG + Intronic
1084941950 11:72617706-72617728 CCCCAGGGACAGGCGGAGGCTGG + Intronic
1086161900 11:83731293-83731315 CACCAGGGCCAGTCAGGGGCTGG - Intronic
1087271061 11:96112393-96112415 CTCCAGGGCCTCTGAGAGGCAGG - Intronic
1087780261 11:102294004-102294026 CACCAGGGCCTGTCGGAGGGTGG - Intergenic
1088034939 11:105299960-105299982 CACCAGGGCCTTTCAGGGGCAGG + Intergenic
1088692342 11:112338622-112338644 CTCCAGGTCCATTCTGGGACAGG - Intergenic
1089677450 11:120099285-120099307 CTCTAAGGCCAGTGGGAGGCAGG + Intergenic
1090029805 11:123196430-123196452 CTCCAGGGACATTCAGAGACTGG - Intergenic
1090544707 11:127751285-127751307 CTCCAGGACCTATCGGAGGGTGG - Intergenic
1090717488 11:129442971-129442993 CTCCAGGGCTGTTGGGAGGGAGG + Intronic
1094040188 12:26114162-26114184 CCCCAAGGCCCTTCTGAGGCGGG + Intergenic
1096156929 12:49346183-49346205 CTGCAGGGCGAGGCGGAGGCAGG + Intergenic
1097401975 12:59139030-59139052 CACCAGGGCCTGTCGGGGGCTGG - Intergenic
1098472739 12:70864432-70864454 TTCCAGGGCCTGTGGGAGGCAGG + Intronic
1098546552 12:71718022-71718044 CTCTAGGGGCATTTGGAGGTCGG - Intergenic
1098815695 12:75159103-75159125 CACCAGGGCCTGTCGGAGGGTGG + Intronic
1099994592 12:89764553-89764575 CACCAGGGCCTTTCAGAGGATGG + Intergenic
1101409983 12:104459281-104459303 CTCCAGGGCCCACCGGAGACCGG + Intronic
1103884379 12:124189739-124189761 CTCCAGGGGCTTTAGGAGGAGGG + Intronic
1104727210 12:131085401-131085423 CTCCAAGGCCCTGGGGAGGCGGG + Intronic
1104936008 12:132364828-132364850 GTCCAGGGCCACTCACAGGCGGG + Intergenic
1104936019 12:132364863-132364885 GTCCAGGGCCACTCACAGGCGGG + Intergenic
1104936080 12:132365073-132365095 GTCCAGGGCCACTCACAGGCGGG + Intergenic
1106413095 13:29524597-29524619 CCCCAGGGCCCCTCGGAGGAAGG + Intronic
1106912242 13:34475360-34475382 CACCAGGGCCTTTCGGGGGTTGG - Intergenic
1108199055 13:48024772-48024794 CACCAGGGCCTGTCGGGGGCTGG + Intergenic
1108740363 13:53331083-53331105 CTCTAGGGACATTGTGAGGCTGG + Intergenic
1112299106 13:98214013-98214035 GTCCAGGGCCCTGCGGTGGCAGG - Intronic
1114269951 14:21094459-21094481 GTCCAGGGCTGTTCCGAGGCAGG + Intronic
1116875707 14:50109490-50109512 ATTCAGGGCCATTGGCAGGCAGG + Exonic
1117600629 14:57370538-57370560 CACCAGGGCCTGTCGGGGGCTGG + Intergenic
1121432994 14:93900476-93900498 GTCCAGGGCCATGTGGAGGGTGG - Intergenic
1122816416 14:104316296-104316318 CTCCAGGGCCAGTCCCAGCCTGG + Intergenic
1122928940 14:104924512-104924534 CTCCACTGCCATTGGGAGCCAGG - Intergenic
1127804961 15:62510656-62510678 CTCCAGGGCGATGCTGTGGCAGG + Intronic
1127960704 15:63888308-63888330 CCCCAGGGCCAGGCTGAGGCTGG - Intergenic
1128610771 15:69071377-69071399 TTCCAGGGCCATTGGGAAGATGG - Intergenic
1128632340 15:69279651-69279673 CTCCCGGGCCATGCTGATGCTGG - Intergenic
1128664800 15:69530323-69530345 CTTCAGGGCCATTTGGGGACTGG - Intergenic
1129933805 15:79432676-79432698 CTCCGGGGCCAAGCCGAGGCAGG - Intronic
1130360345 15:83179160-83179182 CACCAGGGGCAGTGGGAGGCAGG - Intronic
1131117437 15:89803800-89803822 CCCCAGGGCCATCAGGAGACTGG + Intronic
1132443041 15:101887059-101887081 CTCCATGGACTCTCGGAGGCCGG - Intergenic
1132549481 16:548435-548457 CCCCAGGGCCATTGGGAGCTTGG - Intronic
1132674634 16:1116639-1116661 CTCCAGGTCCATTTCCAGGCTGG - Intergenic
1132692511 16:1187943-1187965 CTCCAGGGCCAGCAGGAGCCAGG + Intronic
1133027503 16:2995154-2995176 CTCCAGGGCCATTCTGAGGTGGG - Intergenic
1133028746 16:2999906-2999928 GTCCATAGCCATTTGGAGGCTGG - Intergenic
1133056762 16:3149310-3149332 CTGCAGGGCCAGTGGGAAGCTGG + Intronic
1136028658 16:27486629-27486651 CTCCAGGGCCATGGAGAGGGTGG + Intronic
1136115488 16:28091784-28091806 CTCGAGTGCCCTTCAGAGGCTGG + Intergenic
1136294162 16:29292162-29292184 ATACAGGGCCACTGGGAGGCCGG + Intergenic
1137798979 16:51245229-51245251 CTCCATGGCCATTAGGAGAGGGG + Intergenic
1138395170 16:56698448-56698470 CTCCTGGGCCATCCGGAGCATGG - Intronic
1138976580 16:62214758-62214780 CTCCAGAGCCATTGGGGGTCAGG + Intergenic
1142100066 16:88266208-88266230 ATGCAGGGCCACTGGGAGGCCGG + Intergenic
1143849215 17:9797106-9797128 CACCAGGGCCAGTCGCAGGGTGG - Intronic
1144661613 17:17074236-17074258 ATCCAGTGCCTTTCGGAGGGCGG - Intronic
1146669304 17:34725852-34725874 CCCCAGGGCCTTTGGGAGCCAGG + Intergenic
1146842599 17:36166256-36166278 GTCCAGGTCCGTTGGGAGGCGGG + Exonic
1146854911 17:36254215-36254237 GTCCAGGTCCGTTGGGAGGCGGG + Exonic
1146865709 17:36334161-36334183 GTCCAGGTCCGTTGGGAGGCGGG - Exonic
1146870811 17:36378107-36378129 GTCCAGGTCCGTTGGGAGGCGGG + Exonic
1147068578 17:37934773-37934795 GTCCAGGTCCGTTGGGAGGCGGG - Exonic
1147073695 17:37978731-37978753 GTCCAGGTCCGTTGGGAGGCGGG + Intronic
1147080101 17:38014310-38014332 GTCCAGGTCCGTTGGGAGGCGGG - Intronic
1147085216 17:38058269-38058291 GTCCAGGTCCGTTGGGAGGCGGG + Exonic
1147096050 17:38138270-38138292 GTCCAGGTCCGTTGGGAGGCGGG - Intergenic
1147101163 17:38182235-38182257 GTCCAGGTCCGTTGGGAGGCGGG + Intergenic
1148283753 17:46370063-46370085 CTCCTGGGCCAGGGGGAGGCAGG + Intergenic
1148305971 17:46587980-46588002 CTCCTGGGCCAGGGGGAGGCAGG + Intergenic
1149845761 17:60008741-60008763 GTCCAGGTCCGTTGGGAGGCGGG + Intergenic
1150084109 17:62265321-62265343 GTCCAGGTCCGTTGGGAGGCGGG + Intergenic
1151079326 17:71310586-71310608 CACCAGGGCCTTTCGGGGGGTGG + Intergenic
1152103155 17:78314402-78314424 CGCCAGGGCCAGGCGGAGGCGGG + Intergenic
1152503074 17:80726061-80726083 CACCAGGGCCATTTGGGGCCGGG - Intronic
1154007004 18:10539497-10539519 CTCCTGGGCCTGTCGGGGGCTGG + Intronic
1157584339 18:48791529-48791551 CCCCAGGGCCAGGCTGAGGCTGG - Intronic
1157833561 18:50879026-50879048 CTCGCGGGCCAATTGGAGGCAGG - Intergenic
1160641892 19:146089-146111 CTCCATGGACTCTCGGAGGCCGG + Intergenic
1161218147 19:3105012-3105034 CTCCAGACCCAGTCTGAGGCAGG + Intronic
1161327022 19:3668926-3668948 CTCCAGGCTCATGCAGAGGCGGG + Intronic
1161516903 19:4701753-4701775 TTCCAGGGCCAGACGAAGGCAGG - Intronic
1161672926 19:5624076-5624098 CTCCCGGGCAGTTCTGAGGCTGG - Intronic
1161682726 19:5687985-5688007 CTCCAGGGACAGTTGGAGGGAGG - Exonic
1162042059 19:7976938-7976960 ATCCAGGGCATTTGGGAGGCTGG - Intronic
1162457033 19:10791610-10791632 CTCCAGGGCCCCCAGGAGGCTGG + Intronic
1162523456 19:11194851-11194873 CCCCAGGGCTATGTGGAGGCTGG - Intronic
1163602637 19:18258090-18258112 CTCCAGGGCCCCGCGGACGCTGG - Exonic
1164279456 19:23756627-23756649 CACCAGGGCCAGTCGGGGGGTGG + Intronic
1165757813 19:38304449-38304471 GTTCAGGGCCGGTCGGAGGCAGG + Exonic
1166893013 19:46006116-46006138 CTCCAGTACCATTCGGTGCCAGG + Intronic
1167024245 19:46903400-46903422 TCCCAGGGCCATTCAGAGCCAGG + Intergenic
1167587214 19:50382003-50382025 CTCGCGGGCCATGCGGCGGCTGG + Exonic
925394017 2:3519401-3519423 CTCCAGGCCCACTGGGCGGCCGG + Exonic
926997183 2:18748707-18748729 CACCGGGGCCAGTCGGCGGCTGG - Intergenic
927192719 2:20527821-20527843 CTCCAGGGCACTTGAGAGGCTGG - Intergenic
928195492 2:29213851-29213873 CTCCAGAGCCATTTGGATGTAGG - Intronic
930356275 2:50324783-50324805 CTCCAGGGCCATCTGGTGGGAGG - Intronic
931152044 2:59585217-59585239 CTCCAGAGCCACTCAGAGGAAGG + Intergenic
933709434 2:85314805-85314827 CTCCAAGCCCCTTCAGAGGCAGG - Intergenic
935411189 2:102765242-102765264 CTACAGGGCAATTGGCAGGCTGG + Intronic
935757629 2:106288867-106288889 CTGCAGGGCCATTCGCAGGATGG - Intergenic
936111122 2:109665684-109665706 CTGCGGGGCCATTCGCAGGATGG + Intergenic
936270859 2:111047590-111047612 CTCCAGGGTCTTTCCCAGGCAGG + Intronic
940104026 2:150077418-150077440 CACCAGGGCCTGTCGGAGGGTGG - Intergenic
942147185 2:173038572-173038594 CACCAGGGCCTGTCGGAGGTTGG + Intronic
943529904 2:189066390-189066412 CTCCAGGGCCAGTGGGAGAAAGG - Exonic
945745999 2:213720171-213720193 CACCAGGGCCTTTCGGGGGCTGG + Intronic
946431836 2:219630400-219630422 CTCCAAGGTCACTCGCAGGCTGG - Intronic
947752870 2:232541862-232541884 CTCCAGGCCCACAGGGAGGCAGG + Intronic
1169117007 20:3072296-3072318 CTCCGGGGCCAGGGGGAGGCGGG + Intronic
1169182252 20:3579898-3579920 CTATAGGGCCATTCTGAGACTGG + Intronic
1172468146 20:35172244-35172266 CTCCAGAACCATCCTGAGGCAGG - Intronic
1172784566 20:37458665-37458687 CTTCAGGGTCCTTCGGAGGGTGG - Intergenic
1175907470 20:62387893-62387915 CTGCGGGGCCATTCGTAGGATGG + Exonic
1176296243 21:5075022-5075044 CTCAGGGTCCCTTCGGAGGCCGG - Intergenic
1176387812 21:6147863-6147885 CTCCAGGGTCACTGGGGGGCCGG - Intergenic
1176975558 21:15316861-15316883 CACCAGGGCCTGTCGGGGGCTGG - Intergenic
1177082731 21:16661288-16661310 CTCCAGGGCCTGTCAGGGGCTGG - Intergenic
1177349178 21:19912927-19912949 CACCAGGGCCTTTCAGAAGCTGG + Intergenic
1177964103 21:27705484-27705506 CACCAGGGCCAGTCAGAGGTGGG - Intergenic
1179022967 21:37656560-37656582 CTGCAGAGCCATGGGGAGGCTGG - Intronic
1179735660 21:43390385-43390407 CTCCAGGGTCACTGGGGGGCCGG + Intergenic
1179860806 21:44187099-44187121 CTCAGGGTCCCTTCGGAGGCCGG + Intergenic
1184949063 22:47827106-47827128 CACCAGGGCCTATCGGAGGGTGG + Intergenic
1185188530 22:49417980-49418002 CTTCAGGGACATTTGCAGGCTGG - Intronic
949246829 3:1934680-1934702 CACCAGGGCCTTTCGGGGGGTGG + Intergenic
950013001 3:9736540-9736562 CTCAAGGGCCATTGGGAGGGAGG - Intronic
950095379 3:10326409-10326431 CTCCATGTTCATTCGGAGCCAGG - Exonic
950619125 3:14188958-14188980 CACCAGGGCCTGTCGGGGGCTGG - Intronic
950714281 3:14836712-14836734 CTCCTGGGCCTTTCTGAGGGTGG - Intronic
951705010 3:25535566-25535588 CACCAGGGCCTGTCGGGGGCTGG - Intronic
953202764 3:40792211-40792233 CTCCAGGTTCATGTGGAGGCAGG - Intergenic
956979049 3:74614870-74614892 GCCCAGGGCCCTGCGGAGGCCGG - Intergenic
958266838 3:91447509-91447531 CCTCATGGCCAATCGGAGGCTGG + Intergenic
961937485 3:130600695-130600717 CACCAGGGCCAGTCGGGGGTTGG + Intronic
963177308 3:142313404-142313426 CTCCAGGGCCCCTCAGAGTCTGG - Intronic
964852242 3:161107028-161107050 CTCAAGGGCCATACAGAAGCAGG + Intronic
965597547 3:170423247-170423269 CTCCTGGCCCATCCGGATGCAGG - Exonic
967095396 3:186173562-186173584 CTCCATGGAAATTTGGAGGCAGG - Intronic
967984886 3:195087211-195087233 CTCCAGGGCCACACGCAGCCTGG - Intronic
969195754 4:5562592-5562614 CTCCAGGGCCCTGGGGAGGTGGG + Exonic
970302828 4:14699729-14699751 CACTGGGGCCATTCGGGGGCTGG + Intergenic
972028752 4:34424100-34424122 CACCAGGGCCTTTAGGAGGGTGG + Intergenic
977666813 4:99652746-99652768 CTCCCGGGCCTTCCGGAGCCTGG - Exonic
985651882 5:1111395-1111417 CTCCAGGGTCAGGCGGGGGCAGG + Intronic
987638964 5:20586488-20586510 CACCAAGGCCTGTCGGAGGCTGG + Intergenic
987777517 5:22387632-22387654 ATCCAGTGCTATTCTGAGGCAGG - Intronic
988619508 5:32808735-32808757 CTCCAGGGCCATTATGAAGCTGG - Intergenic
989163158 5:38410672-38410694 CTCCTGGGCCATAGGGAGGTTGG + Intronic
989196959 5:38725450-38725472 CTCCAGGGCCTTTCTGTAGCAGG + Intergenic
989461459 5:41704161-41704183 CACCAGGGCCTGTCGGAGGCTGG - Intergenic
995545706 5:113228344-113228366 CTCCAGCACCATTCGGGGGGTGG - Intronic
996159685 5:120147163-120147185 CACCAGGGCCGTTTGGAGGGTGG + Intergenic
997456507 5:134021343-134021365 CACCAGGGCCTTTCGGAGGGTGG - Intergenic
997618614 5:135270524-135270546 CTCCATGGCCTCTGGGAGGCGGG + Intronic
1001752601 5:174142971-174142993 CTCCAGGGGCTTTCAGAAGCCGG - Intronic
1002294703 5:178223929-178223951 CTCCAGGGCTATGTGGAGGATGG - Intronic
1002382472 5:178840444-178840466 CTCTGGGCCCACTCGGAGGCTGG - Intergenic
1002734967 5:181378395-181378417 CTCCATGGACTCTCGGAGGCCGG - Intergenic
1002749560 6:95727-95749 CTCCATGGACTCTCGGAGGCCGG + Intergenic
1002840727 6:903080-903102 GTCCAGGGACCTTCTGAGGCTGG + Intergenic
1003152258 6:3562892-3562914 CACCGGGTCCATCCGGAGGCAGG + Intergenic
1007420213 6:41714747-41714769 CTCCAGGGCCTCTCTGGGGCCGG - Intronic
1007740559 6:44006952-44006974 CTCCAGGGCCATGCAGATGCAGG - Intergenic
1008591633 6:52999268-52999290 CACCAGGGCCAGTCGGGGGGTGG + Intergenic
1008988372 6:57574087-57574109 CCTCATGGCCAATCGGAGGCTGG - Intronic
1009176984 6:60472676-60472698 CCTCATGGCCAATCGGAGGCTGG - Intergenic
1009673499 6:66787729-66787751 CTCCAGGGACATGAGGAGGCTGG - Intergenic
1012359539 6:98360204-98360226 CTACAGAGCCATTTGGAAGCTGG - Intergenic
1012591954 6:100992724-100992746 CACCAGGGCCTTTCGGGGGTTGG + Intergenic
1012805340 6:103886146-103886168 TTCCAGGGCCATGTAGAGGCAGG - Intergenic
1016575141 6:145561884-145561906 CACCAGGGCCAGTCGGTGGGTGG + Intronic
1018498725 6:164379161-164379183 CTGCACGGCCATTCGTAGCCCGG - Intergenic
1019239227 6:170650712-170650734 CTCCATGGACTCTCGGAGGCCGG - Intergenic
1019446109 7:1072164-1072186 CTCCAGGACCATGGGGAGGTGGG - Intronic
1019574113 7:1728045-1728067 GTCCAGAGCCATTGAGAGGCAGG + Intronic
1021888399 7:25163391-25163413 CTCCAGGGCCATTCGGAGGCTGG - Intronic
1022721097 7:32942653-32942675 CTCCAGGGCCCCTCCGTGGCCGG + Intergenic
1024205339 7:47154676-47154698 CTCCAGGTCCACTCCAAGGCAGG + Intergenic
1027129905 7:75583319-75583341 CTCCAGGGACAGTCGGCAGCCGG - Intronic
1027150877 7:75732851-75732873 CACCAGGGCCATTAGGATGTTGG - Intronic
1028461234 7:91095376-91095398 CTGCAGGGCCATTCCTTGGCTGG - Intronic
1032410221 7:131689170-131689192 CTCCAGGGCCATACTGAAGGTGG - Intergenic
1032688952 7:134263290-134263312 CTCCAGGGACTTTGGGAAGCAGG - Intronic
1033430596 7:141285927-141285949 CTCCAGGGCCTGTCAGAGGATGG + Intronic
1033827789 7:145213316-145213338 CTCCAGGGCCTGTCGGTGGGTGG - Intergenic
1035182220 7:157097700-157097722 CTCCAGGGACAGGCGGTGGCAGG + Intergenic
1035508543 8:155896-155918 CTCCATGGACTCTCGGAGGCCGG + Intergenic
1038197646 8:25382799-25382821 CTCCCAGGCCATTAGGAGGAGGG + Intronic
1038562366 8:28591348-28591370 CTTCAGGCACATGCGGAGGCGGG + Intergenic
1047691110 8:127355538-127355560 CTCCAGGGGCATGATGAGGCTGG - Intergenic
1050661301 9:7885881-7885903 CACCAGGGCCAGTCAGAGGGTGG + Intronic
1051691077 9:19712915-19712937 CTCCAGGGACATTTGGTGTCTGG - Intronic
1053593314 9:39534325-39534347 CTCCAAGGCTATGCGGAGGTTGG + Intergenic
1053851048 9:42289033-42289055 CTCCAAGGCTATGCGGAGGTGGG + Intergenic
1054572992 9:66830952-66830974 CTCCAAGGCTATGCGGAGGTTGG - Intergenic
1055208973 9:73766196-73766218 CACCAGGGCCAGTCGGGGGTGGG + Intergenic
1056871688 9:90287755-90287777 CTTCAGGGCCAGCCTGAGGCAGG + Intergenic
1057304891 9:93906334-93906356 CTGCAGGGCCGTGAGGAGGCGGG + Intergenic
1058208241 9:102134773-102134795 CACCAGGGCCAGTCGGGGGATGG + Intergenic
1058429196 9:104903333-104903355 CTCAGGGGCGATTCGGAGCCAGG + Intronic
1058991649 9:110259293-110259315 CTCCAGTCCCATGTGGAGGCTGG - Intergenic
1062375918 9:136261869-136261891 CTCCAGGGCCATTTCGAGCCCGG + Intergenic
1062555594 9:137112301-137112323 CTGCAGGACCATTCCGAGGGGGG - Intronic
1062759435 9:138331003-138331025 CTCCATGGACTCTCGGAGGCCGG - Intergenic
1203599882 Un_KI270748v1:1775-1797 CTCCATGGACTCTCGGAGGCCGG - Intergenic
1185491525 X:520983-521005 CACCAGGGCCTGTCGGGGGCTGG + Intergenic
1186240542 X:7560895-7560917 CTCCAGGGACAATGGGAGGGTGG - Intergenic
1186318103 X:8392923-8392945 CACCAGGGCCAATCGGGGGAAGG + Intergenic
1192576509 X:72247209-72247231 TTCCAGGTCCATCTGGAGGCAGG - Intronic
1192630877 X:72777177-72777199 GTCCACGGGCATTCGGCGGCCGG - Exonic
1192650832 X:72943624-72943646 GTCCACGGGCATTCGGCGGCCGG + Intronic
1193244725 X:79214492-79214514 CACCAGGGCCATTGGGGGGTGGG - Intergenic
1193303401 X:79920301-79920323 CACCAGGGCCTGTCGGAGGTAGG + Intergenic
1194509850 X:94780381-94780403 CTCCAGGGCCTGTCAGGGGCTGG + Intergenic
1195286746 X:103392931-103392953 CACTGGGGCCATTCGGAGGGTGG + Intergenic
1199709817 X:150461134-150461156 CTCCAGGCCCATTTGGCGGGTGG - Intronic
1200038287 X:153347158-153347180 CTCCAGGGCCCTACTGGGGCCGG - Exonic