ID: 1021893054

View in Genome Browser
Species Human (GRCh38)
Location 7:25206084-25206106
Sequence GATTTCATGGAGATTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021893048_1021893054 -10 Left 1021893048 7:25206071-25206093 CCTCCCTCATCAGGATTTCATGG No data
Right 1021893054 7:25206084-25206106 GATTTCATGGAGATTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021893054 Original CRISPR GATTTCATGGAGATTGTGGA GGG Intergenic
No off target data available for this crispr