ID: 1021894759

View in Genome Browser
Species Human (GRCh38)
Location 7:25223362-25223384
Sequence GGTCTTAGCAAACCACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021894759_1021894764 9 Left 1021894759 7:25223362-25223384 CCTGCTTGTGGTTTGCTAAGACC No data
Right 1021894764 7:25223394-25223416 CACAGCAGCCCTCCCTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021894759 Original CRISPR GGTCTTAGCAAACCACAAGC AGG (reversed) Intergenic
No off target data available for this crispr