ID: 1021898722

View in Genome Browser
Species Human (GRCh38)
Location 7:25262304-25262326
Sequence TGAACCCTCTGAATGAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021898722_1021898725 16 Left 1021898722 7:25262304-25262326 CCTCCTCTCATTCAGAGGGTTCA No data
Right 1021898725 7:25262343-25262365 GATGAGAAACACAAAGACATAGG No data
1021898722_1021898724 -6 Left 1021898722 7:25262304-25262326 CCTCCTCTCATTCAGAGGGTTCA No data
Right 1021898724 7:25262321-25262343 GGTTCAGCATGAGTGTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021898722 Original CRISPR TGAACCCTCTGAATGAGAGG AGG (reversed) Intergenic
No off target data available for this crispr