ID: 1021900363

View in Genome Browser
Species Human (GRCh38)
Location 7:25279251-25279273
Sequence GATGGTGCCTGCCCACGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021900363_1021900365 -9 Left 1021900363 7:25279251-25279273 CCTCAACGTGGGCAGGCACCATC No data
Right 1021900365 7:25279265-25279287 GGCACCATCCAAACAGCTGAGGG No data
1021900363_1021900373 25 Left 1021900363 7:25279251-25279273 CCTCAACGTGGGCAGGCACCATC No data
Right 1021900373 7:25279299-25279321 CAAAAAGGCAGGCAGAGGAAGGG No data
1021900363_1021900364 -10 Left 1021900363 7:25279251-25279273 CCTCAACGTGGGCAGGCACCATC No data
Right 1021900364 7:25279264-25279286 AGGCACCATCCAAACAGCTGAGG No data
1021900363_1021900369 10 Left 1021900363 7:25279251-25279273 CCTCAACGTGGGCAGGCACCATC No data
Right 1021900369 7:25279284-25279306 AGGGCTCAGATGGAACAAAAAGG No data
1021900363_1021900368 0 Left 1021900363 7:25279251-25279273 CCTCAACGTGGGCAGGCACCATC No data
Right 1021900368 7:25279274-25279296 CAAACAGCTGAGGGCTCAGATGG No data
1021900363_1021900372 24 Left 1021900363 7:25279251-25279273 CCTCAACGTGGGCAGGCACCATC No data
Right 1021900372 7:25279298-25279320 ACAAAAAGGCAGGCAGAGGAAGG No data
1021900363_1021900370 14 Left 1021900363 7:25279251-25279273 CCTCAACGTGGGCAGGCACCATC No data
Right 1021900370 7:25279288-25279310 CTCAGATGGAACAAAAAGGCAGG No data
1021900363_1021900371 20 Left 1021900363 7:25279251-25279273 CCTCAACGTGGGCAGGCACCATC No data
Right 1021900371 7:25279294-25279316 TGGAACAAAAAGGCAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021900363 Original CRISPR GATGGTGCCTGCCCACGTTG AGG (reversed) Intergenic