ID: 1021902379

View in Genome Browser
Species Human (GRCh38)
Location 7:25298862-25298884
Sequence CCAGCAGAGACTGCCGTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021902372_1021902379 12 Left 1021902372 7:25298827-25298849 CCCTTATTTTACTGTTTTCACTT No data
Right 1021902379 7:25298862-25298884 CCAGCAGAGACTGCCGTCATAGG No data
1021902373_1021902379 11 Left 1021902373 7:25298828-25298850 CCTTATTTTACTGTTTTCACTTA No data
Right 1021902379 7:25298862-25298884 CCAGCAGAGACTGCCGTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021902379 Original CRISPR CCAGCAGAGACTGCCGTCAT AGG Intergenic
No off target data available for this crispr