ID: 1021902524

View in Genome Browser
Species Human (GRCh38)
Location 7:25300764-25300786
Sequence AGCACGCTTCTCACTACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021902524_1021902525 29 Left 1021902524 7:25300764-25300786 CCATGTGTAGTGAGAAGCGTGCT No data
Right 1021902525 7:25300816-25300838 TTCTTCAAGTGACCAACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021902524 Original CRISPR AGCACGCTTCTCACTACACA TGG (reversed) Intergenic
No off target data available for this crispr