ID: 1021910601

View in Genome Browser
Species Human (GRCh38)
Location 7:25382510-25382532
Sequence CCCAATACACAGCTGTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021910592_1021910601 12 Left 1021910592 7:25382475-25382497 CCCTCTGGTTGAGGGAGATGAAA No data
Right 1021910601 7:25382510-25382532 CCCAATACACAGCTGTTGGAGGG No data
1021910593_1021910601 11 Left 1021910593 7:25382476-25382498 CCTCTGGTTGAGGGAGATGAAAA No data
Right 1021910601 7:25382510-25382532 CCCAATACACAGCTGTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021910601 Original CRISPR CCCAATACACAGCTGTTGGA GGG Intergenic
No off target data available for this crispr