ID: 1021910601 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:25382510-25382532 |
| Sequence | CCCAATACACAGCTGTTGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1021910592_1021910601 | 12 | Left | 1021910592 | 7:25382475-25382497 | CCCTCTGGTTGAGGGAGATGAAA | No data | ||
| Right | 1021910601 | 7:25382510-25382532 | CCCAATACACAGCTGTTGGAGGG | No data | ||||
| 1021910593_1021910601 | 11 | Left | 1021910593 | 7:25382476-25382498 | CCTCTGGTTGAGGGAGATGAAAA | No data | ||
| Right | 1021910601 | 7:25382510-25382532 | CCCAATACACAGCTGTTGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1021910601 | Original CRISPR | CCCAATACACAGCTGTTGGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||