ID: 1021921893

View in Genome Browser
Species Human (GRCh38)
Location 7:25494179-25494201
Sequence TGTGTGCTAGAGCACTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021921891_1021921893 0 Left 1021921891 7:25494156-25494178 CCTCATACTGATTGAGCACCTAC No data
Right 1021921893 7:25494179-25494201 TGTGTGCTAGAGCACTCTGCAGG No data
1021921890_1021921893 1 Left 1021921890 7:25494155-25494177 CCCTCATACTGATTGAGCACCTA No data
Right 1021921893 7:25494179-25494201 TGTGTGCTAGAGCACTCTGCAGG No data
1021921889_1021921893 2 Left 1021921889 7:25494154-25494176 CCCCTCATACTGATTGAGCACCT No data
Right 1021921893 7:25494179-25494201 TGTGTGCTAGAGCACTCTGCAGG No data
1021921886_1021921893 18 Left 1021921886 7:25494138-25494160 CCATCAAACCGAACCACCCCTCA No data
Right 1021921893 7:25494179-25494201 TGTGTGCTAGAGCACTCTGCAGG No data
1021921887_1021921893 10 Left 1021921887 7:25494146-25494168 CCGAACCACCCCTCATACTGATT No data
Right 1021921893 7:25494179-25494201 TGTGTGCTAGAGCACTCTGCAGG No data
1021921888_1021921893 5 Left 1021921888 7:25494151-25494173 CCACCCCTCATACTGATTGAGCA No data
Right 1021921893 7:25494179-25494201 TGTGTGCTAGAGCACTCTGCAGG No data
1021921885_1021921893 19 Left 1021921885 7:25494137-25494159 CCCATCAAACCGAACCACCCCTC No data
Right 1021921893 7:25494179-25494201 TGTGTGCTAGAGCACTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021921893 Original CRISPR TGTGTGCTAGAGCACTCTGC AGG Intergenic
No off target data available for this crispr