ID: 1021922972

View in Genome Browser
Species Human (GRCh38)
Location 7:25505666-25505688
Sequence CTGAGGCATAAGCCTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021922972_1021922974 -2 Left 1021922972 7:25505666-25505688 CCAGCAGCAGGCTTATGCCTCAG No data
Right 1021922974 7:25505687-25505709 AGAGAAAGAATCTGTGCACTTGG No data
1021922972_1021922975 -1 Left 1021922972 7:25505666-25505688 CCAGCAGCAGGCTTATGCCTCAG No data
Right 1021922975 7:25505688-25505710 GAGAAAGAATCTGTGCACTTGGG 0: 9
1: 44
2: 103
3: 198
4: 537
1021922972_1021922976 4 Left 1021922972 7:25505666-25505688 CCAGCAGCAGGCTTATGCCTCAG No data
Right 1021922976 7:25505693-25505715 AGAATCTGTGCACTTGGGTGAGG No data
1021922972_1021922977 5 Left 1021922972 7:25505666-25505688 CCAGCAGCAGGCTTATGCCTCAG No data
Right 1021922977 7:25505694-25505716 GAATCTGTGCACTTGGGTGAGGG No data
1021922972_1021922978 24 Left 1021922972 7:25505666-25505688 CCAGCAGCAGGCTTATGCCTCAG No data
Right 1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021922972 Original CRISPR CTGAGGCATAAGCCTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr