ID: 1021922973

View in Genome Browser
Species Human (GRCh38)
Location 7:25505683-25505705
Sequence GTGCACAGATTCTTTCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021922973_1021922978 7 Left 1021922973 7:25505683-25505705 CCTCAGAGAAAGAATCTGTGCAC No data
Right 1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG No data
1021922973_1021922979 19 Left 1021922973 7:25505683-25505705 CCTCAGAGAAAGAATCTGTGCAC No data
Right 1021922979 7:25505725-25505747 ATGACTGTAGGACTTTGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021922973 Original CRISPR GTGCACAGATTCTTTCTCTG AGG (reversed) Intergenic
No off target data available for this crispr