ID: 1021922978

View in Genome Browser
Species Human (GRCh38)
Location 7:25505713-25505735
Sequence AGGGACAGCACAATGACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021922973_1021922978 7 Left 1021922973 7:25505683-25505705 CCTCAGAGAAAGAATCTGTGCAC No data
Right 1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG No data
1021922972_1021922978 24 Left 1021922972 7:25505666-25505688 CCAGCAGCAGGCTTATGCCTCAG No data
Right 1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021922978 Original CRISPR AGGGACAGCACAATGACTGT AGG Intergenic
No off target data available for this crispr