ID: 1021928090

View in Genome Browser
Species Human (GRCh38)
Location 7:25552541-25552563
Sequence ACAATTTTTTTAAAAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021928090_1021928095 0 Left 1021928090 7:25552541-25552563 CCAGATTTTTTTAAAAAAATTGT No data
Right 1021928095 7:25552564-25552586 AATTGGATGGTGGTTGGTGATGG No data
1021928090_1021928098 7 Left 1021928090 7:25552541-25552563 CCAGATTTTTTTAAAAAAATTGT No data
Right 1021928098 7:25552571-25552593 TGGTGGTTGGTGATGGCGAGGGG No data
1021928090_1021928094 -6 Left 1021928090 7:25552541-25552563 CCAGATTTTTTTAAAAAAATTGT No data
Right 1021928094 7:25552558-25552580 AATTGTAATTGGATGGTGGTTGG No data
1021928090_1021928096 5 Left 1021928090 7:25552541-25552563 CCAGATTTTTTTAAAAAAATTGT No data
Right 1021928096 7:25552569-25552591 GATGGTGGTTGGTGATGGCGAGG No data
1021928090_1021928097 6 Left 1021928090 7:25552541-25552563 CCAGATTTTTTTAAAAAAATTGT No data
Right 1021928097 7:25552570-25552592 ATGGTGGTTGGTGATGGCGAGGG No data
1021928090_1021928093 -10 Left 1021928090 7:25552541-25552563 CCAGATTTTTTTAAAAAAATTGT No data
Right 1021928093 7:25552554-25552576 AAAAAATTGTAATTGGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021928090 Original CRISPR ACAATTTTTTTAAAAAAATC TGG (reversed) Intergenic
No off target data available for this crispr