ID: 1021928094

View in Genome Browser
Species Human (GRCh38)
Location 7:25552558-25552580
Sequence AATTGTAATTGGATGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021928090_1021928094 -6 Left 1021928090 7:25552541-25552563 CCAGATTTTTTTAAAAAAATTGT No data
Right 1021928094 7:25552558-25552580 AATTGTAATTGGATGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021928094 Original CRISPR AATTGTAATTGGATGGTGGT TGG Intergenic
No off target data available for this crispr