ID: 1021934928

View in Genome Browser
Species Human (GRCh38)
Location 7:25620895-25620917
Sequence CAGAATAAGGTGGTGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021934928_1021934935 7 Left 1021934928 7:25620895-25620917 CCAGCCACCACCACCTTATTCTG No data
Right 1021934935 7:25620925-25620947 ATTTCCTCATCTGTAGAACAGGG No data
1021934928_1021934934 6 Left 1021934928 7:25620895-25620917 CCAGCCACCACCACCTTATTCTG No data
Right 1021934934 7:25620924-25620946 CATTTCCTCATCTGTAGAACAGG 0: 3
1: 19
2: 213
3: 1158
4: 4728

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021934928 Original CRISPR CAGAATAAGGTGGTGGTGGC TGG (reversed) Intergenic
No off target data available for this crispr