ID: 1021936410

View in Genome Browser
Species Human (GRCh38)
Location 7:25636430-25636452
Sequence GAGAGAGTCACATCCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021936404_1021936410 19 Left 1021936404 7:25636388-25636410 CCATAAGAAGAGGAGTGATTGTT No data
Right 1021936410 7:25636430-25636452 GAGAGAGTCACATCCATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021936410 Original CRISPR GAGAGAGTCACATCCATGGA GGG Intergenic
No off target data available for this crispr